Jump to content

Genome: Difference between revisions

From 太極
Brb (talk | contribs)
Brb (talk | contribs)
 
(466 intermediate revisions by the same user not shown)
Line 1: Line 1:
= Visualization =
= Visualization =
See also [http://www.bioconductor.org/packages/release/BiocViews.html#___Visualization Bioconductor > BiocViews > Visualization]. Search 'genom' as the keyword.
* [https://github.com/cmdcolin/awesome-genome-visualization Awesome genome visualization]
* [http://www.bioconductor.org/packages/release/BiocViews.html#___Visualization Bioconductor > BiocViews > Visualization]. Search 'genom' as the keyword.
 
== Ten simple rules ==
[https://journals.plos.org/ploscompbiol/article?id=10.1371%2Fjournal.pcbi.1010622 Ten simple rules for developing visualization tools in genomics]


== [http://software.broadinstitute.org/software/igv/ IGV] ==
== [http://software.broadinstitute.org/software/igv/ IGV] ==
Line 37: Line 41:
* DNA: no matter it is whole genome or whole exome, the coverage is more even. For whole exome, there is no splicing.
* DNA: no matter it is whole genome or whole exome, the coverage is more even. For whole exome, there is no splicing.
* RNA: focusing on expression so the coverage changes a lot. The base name still A,C,G,T (not A,C,G,U).
* RNA: focusing on expression so the coverage changes a lot. The base name still A,C,G,T (not A,C,G,U).
=== ChromoMap ===
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-021-04556-z ChromoMap]: an R package for interactive visualization of multi-omics data and annotation of chromosomes


== RNA-seq DRaMA ==
== RNA-seq DRaMA ==
Line 50: Line 57:


== [http://www.bioconductor.org/packages/release/bioc/html/ggbio.html ggbio] ==
== [http://www.bioconductor.org/packages/release/bioc/html/ggbio.html ggbio] ==
[https://support.bioconductor.org/p/9152800/ Wondering how to look at the reads of a gene in samples to check if it was knocked out?]


== [http://www.bioconductor.org/packages/release/bioc/html/NOISeq.html NOISeq] package ==
== [http://www.bioconductor.org/packages/release/bioc/html/NOISeq.html NOISeq] package ==
Line 65: Line 73:
See fig on p22 of [http://www.bioconductor.org/packages/release/bioc/vignettes/Sushi/inst/doc/Sushi.pdf Sushi vignette] where genes with different strands are shown with different directions when plotGenes() was used. plotGenes() can be used to plot gene structures that are stored in bed format.
See fig on p22 of [http://www.bioconductor.org/packages/release/bioc/vignettes/Sushi/inst/doc/Sushi.pdf Sushi vignette] where genes with different strands are shown with different directions when plotGenes() was used. plotGenes() can be used to plot gene structures that are stored in bed format.


== [http://www.cbioportal.org/ cBioPortal] and TCGA ==
== [http://www.cbioportal.org/ cBioPortal], TCGA, PanCanAtlas ==
* The cBioPortal for Cancer Genomics provides visualization, analysis and download of large-scale cancer genomics data sets.
See [[Tcga|TCGA]].
* https://github.com/cBioPortal/cbioportal
 
* https://gdac.broadinstitute.org/
== TCPA ==
** [https://github.com/RTCGA/RTCGA/blob/master/R/downloadTCGA.R RCTGA::downloadTCGA()] uses the above website. [http://www.bioconductor.org/packages/release/data/experiment/html/RTCGA.RPPA.html RTCGA.RPPA] package
[https://www.tcpaportal.org/tcpa/download.html Download]. Level 4.
** [https://tcpaportal.org/tcpa/index.html The Cancer Proteome Atlas (TCPA)] from MD Anderson
* [http://www.linkedomics.org/ LinkedOmics]. [http://www.linkedomics.org/data_download/TCGA-KIRC/ TCGA-KIRC]
* [https://www.bioconductor.org/packages/release/data/experiment/html/GSE62944.html TCGA processed RNA-Seq data (GSE62944) as a SummarizedExperiment]
* [https://www.biostars.org/p/219024/ Tutorial: retrieve full TCGA datasets from cBioportal with R]
* [https://cran.r-project.org/web/packages/cgdsr/ cgdsr] package
* [http://qiubio.com/new/book/sessionInfo/#cbioportal 生物信息学生R入门教程]
* [http://zyxue.github.io/2017/06/02/understanding-TCGA-mRNA-Level3-analysis-results-files-from-firebrose.html Understanding TCGA mRNA Level3 analysis results files from FireBrowse]
* [https://github.com/jmzeng1314/tcga_example TCGA实战大全]
* UCSCXenaTools
** [https://shixiangwang.github.io/home/en/post/ucscxenatools-201908/ UCSCXenaTools: Retrieve Gene Expression and Clinical Information from UCSC Xena for Survival Analysis]
** https://docs.ropensci.org/UCSCXenaTools/
** Several hubs are used. For example TCGA Hub is from https://tcga.xenahubs.net/


== [http://qualimap.bioinfo.cipf.es/ Qualimap] ==
== [http://qualimap.bioinfo.cipf.es/ Qualimap] ==
Line 91: Line 87:
== dittoSeq ==
== dittoSeq ==
[https://rna-seqblog.com/dittoseq-universal-user-friendly-single-cell-and-bulk-rna-sequencing-visualization-toolkit-bioinformatics/ dittoSeq] – universal user-friendly single-cell and bulk RNA sequencing visualization toolkit, bioinformatics
[https://rna-seqblog.com/dittoseq-universal-user-friendly-single-cell-and-bulk-rna-sequencing-visualization-toolkit-bioinformatics/ dittoSeq] – universal user-friendly single-cell and bulk RNA sequencing visualization toolkit, bioinformatics
== SeqCVIBE ==
[https://www.rna-seqblog.com/seqcvibe-interactive-analysis-exploration-and-visualization-of-rna-seq-data/ SeqCVIBE – interactive analysis, exploration, and visualization of RNA-Seq data]
== ggcoverage ==
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-023-05438-2 ggcoverage: an R package to visualize and annotate genome coverage for various NGS data] 2023


= Copy Number =
= Copy Number =
Line 104: Line 106:
* [https://www.biorxiv.org/content/early/2018/02/06/260927 ximmer] and [https://github.com/ssadedin/ximmer source]
* [https://www.biorxiv.org/content/early/2018/02/06/260927 ximmer] and [https://github.com/ssadedin/ximmer source]
* [https://www.biorxiv.org/content/10.1101/657361v1 dudeML]: A Simple Deep Learning Approach for Detecting Duplications and Deletions in Next-Generation Sequencing Data
* [https://www.biorxiv.org/content/10.1101/657361v1 dudeML]: A Simple Deep Learning Approach for Detecting Duplications and Deletions in Next-Generation Sequencing Data
== CNVkit ==
* https://cnvkit.readthedocs.io/en/stable/
** [https://cnvkit.readthedocs.io/en/stable/pipeline.html#batch batch]: Copy number calling pipeline


== Whole [http://en.wikipedia.org/wiki/Exome_sequencing exome sequencing] != [http://en.wikipedia.org/wiki/Whole_genome_sequencing whole genome sequencing] ==
== Whole [http://en.wikipedia.org/wiki/Exome_sequencing exome sequencing] != [http://en.wikipedia.org/wiki/Whole_genome_sequencing whole genome sequencing] ==
Line 120: Line 126:
== modSaRa2 ==
== modSaRa2 ==
[https://academic.oup.com/bioinformatics/article/35/17/2891/5288773 An accurate and powerful method for copy number variation detection]
[https://academic.oup.com/bioinformatics/article/35/17/2891/5288773 An accurate and powerful method for copy number variation detection]
== Visualization ==
[https://academic.oup.com/bioinformatics/article/37/8/1164/5895301 reconCNV: interactive visualization of copy number data from high-throughput sequencing] 2021


= NGS =
= NGS =
Line 125: Line 134:


See [[NGS|NGS]].
See [[NGS|NGS]].
== mNGS ==
[https://www.top1health.com/Article/93836 找出病原菌的新武器 :總基因體次世代定序是什麼?]


= R and Bioconductor packages =
= R and Bioconductor packages =
== Resources ==
== Resources ==
* [https://cran.r-project.org/web/views/Omics.html CRAN Task View: Genomics, Proteomics, Metabolomics, Transcriptomics, and Other Omics]
* [http://rafalab.github.io/pages/harvardx.html HarvardX Biomedical Data Science Open Online Training], [https://hbctraining.github.io/main/ Bioinformatics Training at the Harvard Chan Bioinformatics Core]
* [http://rafalab.github.io/pages/harvardx.html HarvardX Biomedical Data Science Open Online Training], [https://hbctraining.github.io/main/ Bioinformatics Training at the Harvard Chan Bioinformatics Core]
* [https://liulab-dfci.github.io/bioinfo-combio/ Introduction to Bioinformatics and Computational Biology] Xiaole Shirley Liu (ebook & videos)
* [https://bioconductor.org/help/course-materials/2017/CSAMA/ CSAMA 2017: Statistical Data Analysis for Genome-Scale Biology]
* [https://bioconductor.org/help/course-materials/2017/CSAMA/ CSAMA 2017: Statistical Data Analysis for Genome-Scale Biology]
* [https://nsaunders.wordpress.com/2015/04/28/some-basics-of-biomart/ Some basics of biomaRt] (and GenomicRanges)
* [https://nsaunders.wordpress.com/2015/04/28/some-basics-of-biomart/ Some basics of biomaRt] (and GenomicRanges)
Line 149: Line 163:
* [https://rpubs.com/achitsaz/97976 RNA-seq Analysis Example] This is a script that will do differential gene expression (DGE) analysis for RNA-seq experiments using the bioconductor package edgeR. RPKMs were calculated for bar plots.
* [https://rpubs.com/achitsaz/97976 RNA-seq Analysis Example] This is a script that will do differential gene expression (DGE) analysis for RNA-seq experiments using the bioconductor package edgeR. RPKMs were calculated for bar plots.
* [https://github.com/pgpmartin/BioC_For_NGS/blob/master/BioC_for_NGS_PMartin.pdf An introduction to R and Bioconductor for the analysis of high-throughput sequencing data] by Pascal MARTIN Oct 2018
* [https://github.com/pgpmartin/BioC_For_NGS/blob/master/BioC_for_NGS_PMartin.pdf An introduction to R and Bioconductor for the analysis of high-throughput sequencing data] by Pascal MARTIN Oct 2018
* [https://morphoscape.wordpress.com/2022/07/28/bioinformatics-analysis-of-omics-data-with-the-shell-r/ Bioinformatics Analysis of Omics Data with the Shell & R]


=== Docker ===
=== Docker ===
Line 154: Line 169:


== Some workflows ==
== Some workflows ==
=== [http://www.bioconductor.org/help/workflows/rnaseqGene/ RNA-Seq workflow] ===  
=== RNA-Seq workflow ===  
Gene-level exploratory analysis and differential expression. A non stranded-specific and paired-end rna-seq experiment was used for the tutorial.
Gene-level exploratory analysis and differential expression. A non stranded-specific and paired-end rna-seq experiment was used for the tutorial.
<pre>
<pre>
Line 164: Line 179:
   gtf ----------------> txdb ---------------> genes -----|
   gtf ----------------> txdb ---------------> genes -----|
</pre>
</pre>
 
* https://bioconductor.org/packages/3.12/workflows/
[http://www.sthda.com/english/wiki/rna-seq-differential-expression-work-flow-using-deseq2 RNA-Seq differential expression work flow using DESeq2]
* [http://www.bioconductor.org/help/workflows/rnaseqGene/ RNA-Seq workflow]
* [https://www.bioconductor.org/packages/release/workflows/html/RnaSeqGeneEdgeRQL.html RnaSeqGeneEdgeRQL]
* [http://www.sthda.com/english/wiki/rna-seq-differential-expression-work-flow-using-deseq2 RNA-Seq differential expression work flow using DESeq2]
* [https://docs.gdc.cancer.gov/Data/Bioinformatics_Pipelines/Expression_mRNA_Pipeline/ mRNA Analysis Pipeline] from NIC GDC


=== rnaseqGene ===
=== rnaseqGene ===
Line 233: Line 251:
* [https://github.com/LieberInstitute/recountWorkshop2020 Human RNA-seq data from recount2 and related packages] from [https://bioc2020.bioconductor.org/workshops BioC 2020 Workshop]
* [https://github.com/LieberInstitute/recountWorkshop2020 Human RNA-seq data from recount2 and related packages] from [https://bioc2020.bioconductor.org/workshops BioC 2020 Workshop]
** recount2 works with DESeq2, edgeR and limma-voom
** recount2 works with DESeq2, edgeR and limma-voom
=== recount3 ===
* [https://lcolladotor-github-io.translate.goog/rnaseq_LCG-UNAM_2022/datos-de-rna-seq-a-trav%C3%A9s-de-recount3.html?_x_tr_sl=auto&_x_tr_tl=en&_x_tr_hl=en&_x_tr_pto=wapp Intro RNA-seq LCG-UNAM 2022] (Spanish)
* [https://support.bioconductor.org/p/9152538/ Recount3: PCR duplicates].
** [https://www.khanacademy.org/science/ap-biology/gene-expression-and-regulation/biotechnology/a/polymerase-chain-reaction-pcr PCR duplication] can refer to two different things. It can mean the process of making many copies of a specific DNA region using a technique called Polymerase Chain Reaction (PCR). PCR relies on a thermostable DNA polymerase and requires DNA primers designed specifically for the DNA region of interest.
** On the other hand, [https://www.nature.com/articles/nmeth.4268 PCR duplication] can also refer to a problem that occurs when the same DNA fragment is amplified and sequenced multiple times, resulting in identical reads that can bias many types of high-throughput-sequencing experiments. These identical reads are called [https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-018-4933-1 PCR duplicates] and can be eliminated using various methods such as removing all but one read of identical sequences or using '''unique molecular identifiers (UMIs)''' to enable accurate counting and tracking of molecules.
** '''UMI''' stands for Unique Molecular Identifier. [https://dnatech.genomecenter.ucdavis.edu/faqs/what-are-umis-and-why-are-they-used-in-high-throughput-sequencing/ It is a complex index added to sequencing libraries before any PCR amplification steps, enabling the accurate bioinformatic identification of PCR duplicates]. UMIs are also known as '''Molecular Barcodes''' or '''Random Barcodes'''. UMIs are valuable tools for both quantitative sequencing applications and also for genomic variant detection, especially the detection of rare mutations. UMI sequence information in conjunction with alignment coordinates enables grouping of sequencing data into read families representing individual sample DNA or RNA fragments.
** [https://umi-tools.readthedocs.io/en/latest/reference/dedup.html '''dedup'''] - Deduplicate reads using UMI and mapping coordinates
** UMIs can be extracted from a fastq file using awk. For example '''awk 'NR % 4 == 1 {split($0,a,":"); print a[6]}' input.fastq > umis.txt''' . Here we assume the read header is '''@SEQ_ID:LANE:TILE:X:Y:UMI, then the UMI sequence is in the 6th field, following the 5th colon.'''


== dbGap ==
== dbGap ==
Line 264: Line 291:
=== [http://www.bioconductor.org/packages/devel/bioc/html/ComplexHeatmap.html ComplexHeatmap] ===
=== [http://www.bioconductor.org/packages/devel/bioc/html/ComplexHeatmap.html ComplexHeatmap] ===


== [http://www.bioconductor.org/packages/release/bioc/html/limma.html limma] ==
== Read counts ==
* [http://nar.oxfordjournals.org/content/early/2015/01/20/nar.gkv007.long Differential expression analyses for RNA-sequencing and microarray studies]
=== Read, fragment ===
* [http://bioinf.wehi.edu.au/RNAseqCaseStudy/ Case Study] using a Bioconductor R pipeline to analyze RNA-seq data (this is linked from limma package user guide). ''Here we illustrate how to use two Bioconductor packages - '''Rsubread''' and '''limma''' - to perform a complete RNA-seq analysis, including '''Subread''''''Bold text''' read mapping, '''featureCounts''' read summarization, '''voom''' normalization and '''limma''' differential expresssion analysis.''
* [https://biology.stackexchange.com/a/30150 Meaning of the "reads" keyword in terms of RNA-seq or next generation sequencing]. A read refers to the sequence of a cluster that is obtained after the end of the sequencing process which is ultimately the sequence of a section of a unique fragment.
* Unbalanced data, non-normal data, Bartlett's test for equal variance across groups and SAM tests (assumes equal variances just like limma). See [https://support.bioconductor.org/p/47217/ this post].
* [https://www.biostars.org/p/106291/ What is the difference between a Read and a Fragment in RNA-seq?]. Diagram , Pair-end, single-end.  
* In the context of RNA-seq, "read" and "fragment" may refer to slightly different things, but they are related concepts.
** A '''read''' is a short sequence of nucleotides that has been generated by a sequencing machine. These reads are typically around 100-150 bases long. RNA-seq experiments generate millions or billions of reads, and these reads are aligned to a reference genome or transcriptome to determine which reads came from which genes or transcripts, this information is used to quantify gene and transcript expression levels.
** A '''fragment''' is a piece of RNA that has been broken up and converted into a read. In RNA-seq, the first step is to convert the RNA into a library of fragments. To do this, the RNA is typically broken up into smaller pieces using a process called fragmentation. Then, '''adapters''' are added to the ends of the fragments to allow them to be sequenced. The fragments are then converted into a library of reads that can be sequenced using a next-generation sequencing platform.
** In summary, a read is a short sequence of nucleotides that has been generated by a sequencing machine, whereas a fragment is a piece of RNA that has been broken up and converted into a read. The process of fragmentation creates a library of fragments that are then converted into reads that can be sequenced.
* Does one fragment contain 1 read or multiple reads?
** One fragment in RNA-seq can contain multiple reads, depending on the sequencing technology and library preparation protocol used.
** In the process of library preparation, RNA is first fragmented into smaller pieces, then adapters are ligated to the ends of the fragments. The fragments are then amplified using PCR, generating multiple copies of the original fragment. These amplified fragments are then sequenced using a next-generation sequencing platform, generating multiple reads per fragment.
** For example, in '''Illumina''' sequencing, fragments are ligated with adapters, then they are clonally amplified using bridge amplification. This allows for the creation of '''clusters''' of identical copies of the original fragment on a sequencing flow cell. Then, each '''cluster''' is sequenced, generating a large number of reads per fragment.
** In other technologies like '''PacBio''' or '''Nanopore''', the sequencing of a fragment generates only one read, as the technology can read long stretches of DNA, therefore it doesn't need to fragment the RNA prior to sequencing.
** In summary, one fragment in RNA-seq can contain multiple reads, depending on the sequencing technology and library preparation protocol used. '''The number of reads per fragment can vary from one to several thousands.'''
* How many reads in a fragment on average in illumination sequencing?
** The number of reads per fragment in Illumina sequencing can vary depending on the sequencing platform and library preparation protocol used, as well as the sequencing depth and the complexity of the sample. However, on average, one fragment can generate several hundred to several thousand reads in Illumina sequencing.
** When sequencing is performed on the Illumina platform, the process of library preparation includes fragmenting the RNA into smaller pieces, ligating adapters to the ends of the fragments, and then amplifying the fragments using bridge amplification. This allows for the creation of clusters of identical copies of the original fragment on a sequencing flow cell. Then, each cluster is sequenced, generating multiple reads per fragment.
** The number of reads per fragment can also be affected by the sequencing depth, which refers to the total number of reads generated by the sequencing machine. A higher sequencing depth will result in more reads per fragment, while a lower sequencing depth will result in fewer reads per fragment.
** In summary, the number of reads per fragment in Illumina sequencing can vary, but on average, one fragment can generate several hundred to several thousand reads. The number of reads per fragment can be influenced by the sequencing platform, library preparation protocol, sequencing depth, and the complexity of the sample.


== easyRNASeq ==
=== [http://bioconductor.org/packages/release/bioc/html/Rsubread.html Rsubread] ===
Calculates the coverage of high-throughput short-reads against a genome of reference and summarizes it per feature of interest (e.g. exon, gene, transcript). The data can be normalized as 'RPKM' or by the 'DESeq' or 'edgeR' package.
* See [https://support.bioconductor.org/p/65604/ this post] for about C version of the [http://bioinf.wehi.edu.au/featureCounts/ featureCounts] program.
* [https://www.biostars.org/p/96176/ featureCounts vs HTSeq-count]
* [http://bioinformatics.cvr.ac.uk/blog/featurecounts-or-htseq-count/ featureCounts or htseq-count?]
* [https://www.jianshu.com/p/9cc4e8657d62 featurecounts的使用说明]
* [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE62944 GSE62944] TCGA data processed by Rahman M.


== ShortRead ==
=== RSEM ===
Base classes, functions, and methods for representation of high-throughput, short-read sequencing data.
<ul>
<li>[http://deweylab.github.io/RSEM/ RSEM], [https://deweylab.github.io/RSEM/rsem-calculate-expression.html  rsem-calculate-expression] </li>
<li>[https://hpc.nih.gov/apps/rsem.html RSEM on Biowulf]
<syntaxhighlight lang='sh'>
$ mkdir SeqTestdata/RNASeqFibroblast/output
$ sinteractive --cpus-per-task=2 --mem=10g
$ module load rsem bowtie STAR
$ rsem-calculate-expression -p 2 --paired-end --star \
../test.SRR493366_1.fastq ../test.SRR493366_2.fastq \
/fdb/rsem/ref_from_genome/hg19 Sample1 # 12 seconds
$ ls -lthog
total 5.8M
-rw-r----- 1 1.6M Nov 24 13:39 Sample1.genes.results
-rw-r----- 1 2.5M Nov 24 13:39 Sample1.isoforms.results
-rw-r----- 1 1.6M Nov 24 13:39 Sample1.transcript.bam
drwxr-x--- 2 4.0K Nov 24 13:39 Sample1.stat


== [http://www.bioconductor.org/packages/release/bioc/html/Rsamtools.html Rsamtools] ==
$ wc -l Sample1.genes.results
The Rsamtools package provides an interface to BAM files.  
26335 Sample1.genes.results
$ wc -l Sample1.isoforms.results
51399 Sample1.isoforms.results


The main purpose of the Rsamtools package is to import BAM files into R. Rsamtools also provides some facility for file access such as record counting, index file creation, and filtering to create new files containing subsets of the original. An important use case for Rsamtools is as a starting point for creating R objects suitable for a diversity of work flows, e.g., AlignedRead objects in the ShortRead package (for quality assessment and read manipulation), or GAlignments objects in GenomicAlignments package (for RNA-seq and other applications). Those desiring more functionality are encouraged to explore samtools and related software efforts
$ head -2 Sample1.genes.results
 
gene_id transcript_id(s) length effective_length expected_count TPM FPKM
This package provides an interface to the 'samtools', 'bcftools', and 'tabix' utilities (see 'LICENCE') for manipulating SAM (Sequence Alignment / Map), FASTA, binary variant call (BCF) and compressed indexed tab-delimited (tabix) files.
A1BG NM_130786 1766.00 1589.99 0.00 0.00 0.00
 
$ head -2 Sample1.isoforms.results
== [http://www.bioconductor.org/packages/release/bioc/html/IRanges.html IRanges] ==
transcript_id gene_id length effective_length expected_count TPM FPKM IsoPct
IRanges is a fundamental package (see how many packages depend on it) to other packages like '''GenomicRanges''', '''GenomicFeatures''' and '''GenomicAlignments'''. The package defines the IRanges class.  
NM_130786 A1BG 1766 1589.99 0.00 0.00 0.00 0.00
 
$ head -1 /fdb/rsem/ref_from_genome/hg19.transcripts.fa
The '''plotRanges'''() function given in the 'An Introduction to IRanges' vignette shows how to draw an IRanges object.
>NM_130786
$ grep NM_130786 /fdb/igenomes/Homo_sapiens/UCSC/hg19/transcriptInfo.tab
NM_130786 2721192635 2721199328 2721188175 2 8 431185
</syntaxhighlight>
</li>
</ul>
* [http://cshprotocols.cshlp.org/content/2019/6/pdb.prot098368.full An RNA-Seq Protocol for Differential Expression Analysis] Owens 2019
* [https://www.cbioportal.org/ Cbioportal] -> [https://www.cbioportal.org/study/summary?id=brca_tcga_pan_can_atlas_2018 Breast Invasive Carcinoma (TCGA, PanCancer Atlas)] -> Explore selected study -> Original data -> [https://gdc.cancer.gov/about-data/publications/pancanatlas PanCanAtlas Publications] -> RNA (Final) - EBPlusPlusAdjustPANCAN_IlluminaHiSeq_RNASeqV2.geneExp.tsv
* [https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-017-4002-1 Evaluation and comparison of computational tools for RNA-seq isoform quantification] 2017
* [https://www.rna-seqblog.com/the-concepts-of-mean-fragment-length-and-effective-length-in-rna-sequencing/ The Concepts of Mean Fragment Length and Effective Length in RNA Sequencing]
<ul>
<li>RSEM gene level result file (see [[#tximport|here for an example]]) contains 5 essential columns (and the element saved by '''tximport'''() function) excluding transcript_id
<ul>
<li>[https://groups.google.com/g/rsem-users/c/IaZmviqghJc Effective length] &rarr; length. This is different across samples. This is much shorter than Length (e.g. 105 vs 1). </li>
<li>[http://deweylab.biostat.wisc.edu/rsem/rsem-calculate-expression.html Expected count] &rarr; count. This is the sum of the posterior probability of each read comes from this transcript over all reads. </li>
<li>TPM &rarr; abundance. The sum of all transcripts' TPM is 1 million. </li>
<li>FPKM (not kept?). FPKM_i = 10^3 / l_bar * TPM_i for gene i. So for each sample FPKM is a scaling of TPM. </li>
</ul>
<pre>
R> dfpkm[1:5, 1:3] / txi.rsem$abundance[1:5, 1:3]
          144126_210-T_JKQFX5 144126_210-T_JKQFX6 144126_210-T_JKQFX8
5S_rRNA            0.7563603            1.118008          0.8485292
5_8S_rRNA                NaN                NaN                NaN
6M1-18                    NaN                NaN                NaN
7M1-2                    NaN                NaN                NaN
7SK                0.7563751            1.118029          0.8485281
</pre>
<li>An example using [https://www.rdocumentation.org/packages/tximport/versions/1.0.3/topics/tximport tximport::tximport()] and [https://www.rdocumentation.org/packages/DESeq2/versions/1.12.3/topics/DESeqDataSet-class DESeq2::DESeqDataSetFromTximport]. <span style="color: red">Note it directly uses round(expected_count) to get the integer-value counts.</span> See the source of DESeqDataSetFromTximport() [https://github.com/mikelove/DESeq2/blob/6aa81f9906e192eea1fb21cdc492b26ee4a472f1/R/AllClasses.R#L405 here]. The [https://bioconductor.org/packages/release/bioc/vignettes/tximport/inst/doc/tximport.html tximport vignette] has discussed two suggested ways of importing estimates for use with differential gene expression (DGE) methods in the section of "Downstream DGE in Bioconductor". The vignette does not say anything about "expected_count" from RSEM output.
<pre>
txi.rsem <- tximport(files, type = "rsem", txIn = F, txOut = F)
txi.rsem$length[txi.rsem$length == 0] <- 1
names(txi.rsem) # a list,
                # length = effective_length (matrix)
                # counts = expected counts column (matrix), non-integer
                # abundance = TPM (matrix)
                # countsFromAbundance = "no"
# [1] "abundance"          "counts"              "length"           
# [4] "countsFromAbundance"
 
sampleTable <- pheno[, c("EXPID", "PatientID")]
rownames(sampleTable) <- colnames(txi.rsem$counts)
 
dds <- DESeq2::DESeqDataSetFromTximport(txi.rsem, sampleTable, ~ PatientID)
# using counts and average transcript lengths from tximport
#
# The DESeqDataSet class enforces non-negative integer values in the "counts"
#    matrix stored as the first element in the assay list.
dds@assays@data@listData$counts[1:5, 1:3] # integer values. How to compute?
                              # https://support.bioconductor.org/p/9134840/
dds@assays@data@listData$avgTxLength[1:5, 1:3] # effective_length


If we want to make the same plot using the ggplot2 package, we can follow the example in [http://stackoverflow.com/questions/21506724/how-to-plot-overlapping-ranges-with-ggplot2 this post]. Note that disjointBins() returns a vector the bin number for each bins counting on the y-axis.
plot(txi.rsem$counts[,1], dds@assays@data@listData$counts[,1])
abline(0, 1, col = 'red')     # compare expected counts vs integer-value counts
                              # a straight line


=== flank ===
ddsColl1 <- DESeq2::estimateSizeFactors(dds)
The example is obtained from ?IRanges::flank.
# using 'avgTxLength' from assays(dds), correcting for library size
<pre>
# Question: how does the function correct for library size?
ir3 <- IRanges(c(2,5,1), c(3,7,3))
# IRanges of length 3
#    start end width
# [1]    2  3    2
# [2]    5  7    3
# [3]    1  3    3


flank(ir3, 2)
ddsColl2 <- DESeq2::estimateDispersions(ddsColl1)
#     start end width
# gene-wise dispersion estimates
# [1]    0  1    2
# mean-dispersion relationship
# [2]    3  4    2
# final dispersion estimates
# [3]    -1  0    2
# Note: it seems estimateDispersions is not required
# Note: by default flank(ir3, 2) = flank(ir3, 2, start = TRUE, both=FALSE)
#       if we only want to get the normalized count (still need estimateSizeFactors())
# For example, [2,3] => [2,X] => (..., 0, 1, 2) => [0, 1]
# See ArrayTools/R/FilterAndNormalize.R
#                                    == ==


flank(ir3, 2, start=FALSE)
cnts2 <- DESeq2::counts(ddsColl2, normalized = FALSE)
#     start end width
all(dds@assays@data@listData$counts == cnts2)
# [1]    4   5    2
# [1] TRUE
# [2]     8  9    2
 
# [3]     4   5    2
all(round(txi.rsem$counts) == cnts2 )
# For example, [2,3] => [X,3] => (..., 3, 4, 5) => [4,5]
# [1] TRUE.     So in this case round(expected values) = integer-value counts
#                                        == ==
</pre>
</li>
</ul>
* [https://informatics.fas.harvard.edu/rsem-example-on-odyssey.html RSEM example on Odyssey]
* [https://github.com/bli25broad/RSEM_tutorial A Short Tutorial for RSEM]
* [https://ycl6.gitbook.io/rna-seq-data-analysis/ Hands-on Training in RNA-Seq Data Analysis*] which includes Quantification using RSEM and Perform DE analysis. Note the expected count column was used in edgeR.
* [https://biowize.wordpress.com/2014/03/04/understanding-rsem-raw-read-counts-vs-expected-counts/ Understanding RSEM: raw read counts vs expected counts]. These '''“expected counts”''' can then be provided as a matrix (rows = mRNAs, columns = samples) to programs such as EBSeq, DESeq, or edgeR to identify differentially expressed genes.
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-12-323 RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome]. Abundance estimates are given in terms of two measures. The output file (XXX_RNASeq.RSEM.genes.results) contains 7 columns: '''gene_id, transcript_id(s), length,  effective_length, expected_count, TPM, FPKM'''.
** Expected counts: The is an estimate of the number of fragments that are derived from a given isoform or gene.  '''This count is generally a non-integer value''' and is the expectation of the number of alignable and unfiltered fragments that are derived from a isoform or gene given the ML abundances. These (possibly rounded) counts may be used by a differential expression method such as edgeR or DESeq.
** TPM: This is the estimated fraction of transcripts made up by a given isoform or gene. The transcript fraction measure is preferred over the popular RPKM/FPKM measures because '''it is independent of the mean expressed transcript length''' and is thus more comparable across samples and species.
<ul>
<li>The ''length'' or ''effective_length'' are different (though similar) for different samples for the same gene </li>
<li>A scatter plot and correlation shows the expected_count and TPM are different
<pre>
x <- read.delim("144126_210-T_JKQFX5_v2.0.1.4.0_RNASeq.RSEM.genes.results")
colnames(x)
# [1] "gene_id"          "transcript_id.s." "length"          "effective_length"
# [5] "expected_count"   "TPM"              "FPKM"
plot(x[, "TPM"], x[, "expected_count"])
cor(x[, "TPM"], x[, "expected_count"])
# [1] 0.4902708
cor(x[, "TPM"], x[, "expected_count"], method = 'spearman')
# [1] 0.9886384
x[1:5, "length"]
[1] 105.01 161.00 473.00  68.00 304.47


flank(ir3, 2, start=c(FALSE, TRUE, FALSE))
x2 <- read.delim("144126_210-T_JKQFX6_v2.0.1.4.0_RNASeq.RSEM.genes.results")
#    start end width
x2[1:5, "length"]
# [1]     4  5     2
# [1] 105.00 161.00 473.00  68.00 305.27
# [2]     3   4    2
x[1:5, "effective_length"]
# [3]     4   5    2
# [11.03  16.65 293.88  0.00 129.00
# Combine the ideas of the previous 2 cases.
x2[1:5, "effective_length"]
# [11.58  17.82 293.05  0.00 128.86
</pre>
</li>
</ul>
* [https://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-0940-1 A benchmark for RNA-seq quantification pipelines]. 2016 They compare the STAR, TopHat2, and Bowtie2 '''mapping methods''' and the Cufflinks, eXpress , Flux Capacitor, kallisto, RSEM, Sailfish, and Salmon '''quantification methods'''. '''RSEM slightly outperforming the rest.'''
* [https://github.com/qianhuiSenn/scRNA_cell_deconv_benchmark/blob/master/Scripts/Downsample/downsample_read_pancreas_code.txt Downsample reads] from '' Evaluation of Cell Type Annotation R Packages on Single Cell RNA-seq Data'' 2020.


flank(ir3, c(2, -2, 2))
==== Expected_count ====
#    start end width
Number of reads mapping to that transcript
# [1]    0  1    2
# [2]    5  6    2
# [3]    -1  0    2
# The original statement is the same as flank(ir3, c(2, -2, 2), start=T, both=F)
# For example, [5, 7] => [5, X] => ( 5, 6) => [5, 6]
#                                  == ==


flank(ir3, -2, start=F)
<ul>
#    start end width
<li>[https://biowize.wordpress.com/2014/03/04/understanding-rsem-raw-read-counts-vs-expected-counts/ Understanding RSEM: raw read counts vs expected counts] In the ideal case, the expected count estimated by RSEM will be precisely the number of reads mapping to that transcript. However, when counting the number of reads mapped for all transcripts, multireads get counted multiple times, so we can expect that this number will be slightly larger than the expected count for many transcripts.
# [1]     2   3     2
<pre>
# [2]     6   7     2
R> x <- read.delim("41samples/165739~295-R~AM1I30~RNASEQ.genes.results")
# [3]     2   3    2
R> summary(x$expected_count)    # Larger than TPM, contradict to the above statement
# For example, [5, 7] => [X, 7] => (..., 6, 7) => [6, 7]
  Min. 1st Qu.  Median    Mean 3rd Qu.    Max.
#                                      == ==
      0      0      10    1346     556  533634
R> summary(x$TPM)
     Min.  1st Qu.   Median    Mean  3rd Qu.    Max.
    0.00    0.00    0.16    35.58     7.50 70091.93
R> x[1:5, c("expected_count", "TPM")]
   expected_count      TPM
1        6190.00 70091.93
2          0.00     0.00
3           0.00    0.00
4          0.00     0.00
5        795.01   171.67
</pre>
</li>
 
<li>[https://support.bioconductor.org/p/90672/ Expected counts from RSEM in DESeq2?] Yes, RSEM expected counts can be used with DESeq2. Don't use TPM or FPKM because they are already normalized. ''It seems there is no need to do rounding before calling the '''tximport()''' function.''
<syntaxhighlight lang='rsplus'>
# adding
txi$length[txi$length <= 0] <- 1
# before
dds <- DESeqDataSetFromTximport(txi, sampleTable, ~condition)
</syntaxhighlight>
 
<li>[https://www.bioinfo-scrounger.com/archives/482/ Alignment-based的转录本定量-RSEM]/ '''the sum of the posterior probability of each read comes from this transcript over all reads'''
</ul>


flank(ir3, 2, both = TRUE)
==== Examples ====
#    start end width
{{Pre}}
# [1]    0  3    4
$ wc -l 144126_210-T_JKQFX5_v2.0.1.4.0_RNASeq.RSEM.genes.results
# [2]    3  6    4
   28110 144126_210-T_JKQFX5_v2.0.1.4.0_RNASeq.RSEM.genes.results
# [3]   -1   2    4
# The original statement is equivalent to flank(ir3, 2, start=T, both=T)
# (From the manual) If both = TRUE, extends the flanking region width positions into the range.  
#        The resulting range thus straddles the end point, with width positions on either side.
# For example, [2, 3] => [2, X] => (..., 0, 1, 2, 3) => [0, 3]
#                                            ==
#                                      == == == ==


flank(ir3, 2, start=FALSE, both=TRUE)
$ head -n 4 144126_210-T_JKQFX5_v2.0.1.4.0_RNASeq.RSEM.genes.results | cut -f1,3,4,5,6,7
#    start end width
# [1]    2  5    4
# [2]    6  9    4
# [3]    2  5    4
# For example, [2, 3] => [X, 3] => (..., 2, 3, 4, 5) => [4, 5]
#                                          ==
#                                      == == == ==


gene_id   length  effective_length  expected_count TPM   FPKM
5S_rRNA   105.01  1.03             1513.66   31450.7 23788.06
5_8S_rRNA 161   16.65             0           0   0
6M1-18   473   293.88     0           0   0
</pre>
</pre>


Both IRanges and GenomicRanges packages provide the '''flank''' function.
Second example
{{Pre}}
$ wc -l Sample_HS-578T_CB6CRANXX.genes.results
28110
$ head -1 Sample_HS-578T_CB6CRANXX.genes.results
gene_id transcript_id.s. length effective_length expected_count TPM FPKM
$ tail -4Sample_HS-578T_CB6CRANXX.genes.results
septin 9/TNRC6C fusion uc010wto.1 41 0 0 0 0
svRNAa uc022bxg.1 22 0 0 0 0
tRNA Pro uc022bqx.1 65 0 0 0 0
unknown uc002afm.3 1117 922.85 0 0 0


'''Flanking region''' is also a common term in High-throughput sequencing. The [http://www.broadinstitute.org/igv/book/export/html/6 IGV] user guide also has some option related to flanking.
$ wc -l Sample_HS-578T_CB6CRANXX.isoforms.results
* General tab: '''Feature flanking regions (base pairs)'''. IGV adds the flank before and after a feature locus when you zoom to a feature, or when you view gene/loci lists in multiple panels.
78376
* Alignments tab: '''Splice junction track options'''. The minimum amount of nucleotide coverage required on both sides of a junction for a read to be associated with the junction. This affects the coverage of displayed junctions, and the display of junctions covered only by reads with small flanking regions.
$ head -1 Sample_HS-578T_CB6CRANXX.isoforms.results
transcript_id gene_id length effective_length expected_count TPM FPKM IsoPct
$ tail -4 Sample_HS-578T_CB6CRANXX.isoforms.results
uc010wto.1 septin 9/TNRC6C fusion 41 0 0 0 0 0
uc022bxg.1 svRNAa 22 0 0 0 0 0
uc022bqx.1 tRNA Pro 65 0 0 0 0 0
uc002afm.3 unknown 1117 922.85 0 0 0 0
</pre>


== [https://www.bioconductor.org/packages/release/bioc/html/Biostrings.html Biostrings] ==
== [http://www.bioconductor.org/packages/release/bioc/html/limma.html limma] ==
* [http://www.r-exercises.com/2017/05/21/manipulate-biological-data-using-biostrings-package-part-1/ Manipulate Biological Data Using Biostrings Package Exercises (Part 1)]
* [http://nar.oxfordjournals.org/content/early/2015/01/20/nar.gkv007.long Differential expression analyses for RNA-sequencing and microarray studies]
* [http://www.r-exercises.com/2017/05/28/manipulate-biological-data-using-biostrings-package-exercises-part-2/ Manipulate Biological Data Using Biostrings Package Exercises (Part 2)] - it covers global, local & overlap alignments.
* [http://bioinf.wehi.edu.au/RNAseqCaseStudy/ Case Study] using a Bioconductor R pipeline to analyze RNA-seq data (this is linked from limma package user guide). ''Here we illustrate how to use two Bioconductor packages - '''Rsubread''' and '''limma''' - to perform a complete RNA-seq analysis, including '''Subread''''''Bold text''' read mapping, '''featureCounts''' read summarization, '''voom''' normalization and '''limma''' differential expresssion analysis.''
* Unbalanced data, non-normal data, Bartlett's test for equal variance across groups and SAM tests (assumes equal variances just like limma). See [https://support.bioconductor.org/p/47217/ this post].


== [http://www.bioconductor.org/packages/release/bioc/html/GenomicRanges.html GenomicRanges] ==
=== B-statistic ===
GenomicRanges depends on [http://www.bioconductor.org/packages/release/bioc/html/IRanges.html IRanges] package. See the dependency diagram below.
* The “B value” in limma is named after the '''Bayesian''' framework used to compute it.
<pre>
* B = Bayesian log-odds of differential expression
GenomicFeatues ------- GenomicRanges -+- IRanges -- BioGenomics
* B value → Bayesian belief that the gene is truly DE. Higher B value → stronger evidence the gene is differentially expressed.
                        |            +
** '''B = 0 → odds are 1:1 → 50% probability of differential expression'''
                  +-----+            +- GenomeInfoDb
** B > 0 → more likely DE than not
                  |                      |
** B < 0 → less likely DE
GenomicAlignments  +--- Rsamtools --+-----+
* For each gene, it estimates: B = Prob(DE) / (1-Prob(DE))
                                    +--- Biostrings
* Prob(DE) <- exp(B) / (1 + exp(B))
</pre>


The package defines some classes
=== RSEM ===
* GRanges
* [https://support.bioconductor.org/p/84749/ RSEM expected counts to limma-voom]. Choice 1: '''tximport'''. Choice 2: If you are working with '''RSEM gene-level expected counts''', then you can just pass them to limma as if they were counts. That's what we do.
* GRangesList
* [https://stat.ethz.ch/pipermail/bioconductor/2013-November/056309.html Differential expression of RNA-seq data using limma and voom()]
* GAlignments
* SummarizedExperiment: it has the following slots - expData, rowData, colData, and assays. Accessors include assays(), assay(), colData(), expData(), mcols(), ... The mcols() method is defined in the S4Vectors package.


(As of Jan 6, 2015) The introduction in GenomicRanges vignette mentions the ''GAlignments'' object created from a 'BAM' file discarding some information such as SEQ field, QNAME field, QUAL, MAPQ and any other information that is not needed in its document. This means that multi-reads don't receive any special treatment. Also pair-end reads will be treated as single-end reads and the pairing information will be lost. This might change in the future.
=== TMM (Robinson and Oshlack, 2010) ===
Trimmed Means of M values (edgeR).
<ul>
<li>TMM relies on the assumption that most genes are not differentially expressed. See the [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2010-11-3-r25 paper]. DESeq2 does not rely on this assumption. <li>
<li>TMM will not work well for samples where the library size is so small that most of the counts become zero. A library size of 1 million is on the small side, but is probably ok. [https://support.bioconductor.org/p/9149967/ Is there any reason to think that normalization (e.g. TMM) doesn't work well with samples that that have very different raw counts?]
<li>Many normalization RNA-Seq normalization methods perform poorly on samples with '''extreme composition bias'''. For instance, in one sample a large number of reads comes from rRNAs while in another they have been removed more efficiently. Most scaling based methods, including RPKM and CPM, will underestimate the expression of weaker expressed genes in
the presence of extremely abundant mRNAs (less sequencing real estate available for them). The TMM methods tries to correct this bias.
</li>


== [http://www.bioconductor.org/packages/release/bioc/html/GenomicAlignments.html GenomicAlignments] ==
<li>[https://support.bioconductor.org/p/9156103/ Does EdgeR trimmed mean of M values (TMM) account for gene length?] '''No'''. ''In general, edgeR does not need to adjust for gene length in DE analyses because gene length cancels out of DE comparisons.''
=== Counting reads with summarizeOverlaps vignette ===
<li>[https://www.reneshbedre.com/blog/expression_units.html Gene expression units explained: RPM, RPKM, FPKM, TPM, DESeq, TMM, SCnorm, GeTMM, and ComBat-Seq]
<pre>
library(GenomicAlignments)
library(DESeq)
library(edgeR)


fls <- list.files(system.file("extdata", package="GenomicAlignments"),
<li>Q: Does TMM method require count data?
    recursive=TRUE, pattern="*bam$", full=TRUE)
* A: Yes, the TMM method requires RNA-seq count data as input.  
* The TMM method uses these count data to calculate the scaling factors that adjust for differences in library size <strike>and gene length</strike>, as well as the effects of highly expressed genes.
* Before applying the TMM method, it is important to ensure that the count data has been properly preprocessed and filtered to remove low-quality reads, adapter sequences, and other artifacts.
</li>
<li>Q: can TMM method be applied to non-integer data?
* A: It is possible to apply TMM to non-integer data, such as normalized expression values or FPKM (fragments per kilobase of transcript per million mapped reads) values, by rounding the values to the nearest integer.
* In practice, the TMM method can be applied to non-integer data by first converting the data to counts, for example, by multiplying the expression values by a scaling factor that represents the average library size, and then rounding the resulting values to the nearest integer. The TMM method can then be applied to the rounded count data as usual.
</li>
<li>[https://youtu.be/Wdt6jdi-NQo StatQuest: edgeR, part 1, Library Normalization]. Good explanation about reference sample selection. </li>
<li>[https://www.tutorialspoint.com/statistics/trimmed_mean.htm Trimmed Mean] </li>
<li>[https://web.stanford.edu/class/bios221/labs/rnaseq/lab_4_rnaseq.html RNA Sequence Analysis in R: edgeR]
</li>
<li>[https://davetang.org/muse/2011/01/24/normalisation-methods-for-dge-data/ Normalisation methods implemented in edgeR]. TMM, RLE, Upper-quartile. </li>
<li>Using [https://stats.stackexchange.com/a/421903 edgeR] package
<pre>
library(magrittr)
library(edgeR)
set.seed(1)
M <- matrix(rnbinom(10000,mu=5,size=2), ncol=4)


features <- GRanges(
out <- DGEList(M) %>% calcNormFactors() %>% cpm()
    seqnames = c(rep("chr2L", 4), rep("chr2R", 5), rep("chr3L", 2)),
</pre> </li>
    ranges = IRanges(c(1000, 3000, 4000, 7000, 2000, 3000, 3600, 4000,
<li>Using [https://www.bioconductor.org/packages/release/bioc/vignettes/NOISeq/inst/doc/NOISeq.pdf#page=15 NOISeq] package
        7500, 5000, 5400), width=c(rep(500, 3), 600, 900, 500, 300, 900,
<pre>
        300, 500, 500)), "-",
library(NOISeq)
    group_id=c(rep("A", 4), rep("B", 5), rep("C", 2)))
out2 <- tmm(M, long = 1000, lc = 0, k = 0)
features
out[1:3, 1:3] / out2[1:3, 1:3]
#    Sample1  Sample2  Sample3
# 1 80.81611 81.32609      NaN
# 2 80.81611 81.32609 80.81611
# 3 80.81611      NaN 80.81611
</pre> </li>
<li>
</ul>


# GRanges object with 11 ranges and 1 metadata column:
==== TMM + voom (+ lmFit) ====
#      seqnames      ranges strand  |    group_id
Toy data with replication
#          <Rle>   <IRanges> <Rle>   | <character>
<ul>
#  [1]    chr2L [1000, 1499]      -  |          A
<li>Toy counts with replication
#  [2]    chr2L [3000, 3499]      -  |          A
<pre>
#  [3]    chr2L [4000, 4499]      -  |          A
library(edgeR)
#  [4]    chr2L [7000, 7599]      -  |          A
library(limma)
#  [5]    chr2R [2000, 2899]      -  |          B
#  ...      ...          ...    ... ...        ...
#  [7]    chr2R [3600, 3899]      -  |          B
#  [8]    chr2R [4000, 4899]      -  |          B
#  [9]    chr2R [7500, 7799]      -  |          B
#  [10]    chr3L [5000, 5499]      -  |          C
#  [11]    chr3L [5400, 5899]      -  |          C
#  -------
#  seqinfo: 3 sequences from an unspecified genome; no seqlengths
olap
# class: SummarizedExperiment
# dim: 11 2
# exptData(0):
# assays(1): counts
# rownames: NULL
# rowData metadata column names(1): group_id
# colnames(2): sm_treated1.bam sm_untreated1.bam
# colData names(0):


assays(olap)$counts
counts <- matrix(c(
#      sm_treated1.bam sm_untreated1.bam
  10, 12, 100, 120,
# [1,]              0                0
  20, 25, 2000, 1800,
# [2,]              0                0
  30, 28, 300, 310
# [3,]              0                0
), nrow=3, byrow=TRUE)
#  [4,]              0                0
rownames(counts) <- paste0("Gene", 1:3)
# [5,]              5                1
colnames(counts) <- paste0("Sample", 1:4)
# [6,]              5                0
counts
# [7,]              2                 0
#      Sample1 Sample2 Sample3 Sample4
# [8,]            376              104
# Gene1      10      12    100    120
# [9,]              0                0
# Gene2      20      25    2000    1800
# [10,]              0                0
# Gene3      30      28    300    310
# [11,]              0                0
</pre>
<li>TMM: '''correct for composition bias (output is still on counts level)'''
<pre>
dge <- DGEList(counts=counts)
dge <- calcNormFactors(dge, method="TMM")  # TMM normalization
dge$samples
#        group lib.size norm.factors
# Sample1    1       60    1.3544704
# Sample2    1      65    1.3311779
# Sample3    1    2400    0.7175709
# Sample4    1    2230    0.7729112
</pre>
<li>Make design matrix
<pre>
group <- factor(c("A","A","B","B"))
design <- model.matrix(~group)
design
#   (Intercept) groupB
# 1          1      0
# 2           1      0
# 3          1      1
# 4          1      1
</pre>
<li>Run voom ('''calculate log2CPM + weights for lmFit in the next step''')
<pre>
v <- voom(dge, design, plot=TRUE)
# x-axis = mean log2(CPM) for each gene across all samples
# y-axis = square root of the residual variance for each gene
</pre>
</pre>
The plot is very close to the following except shift/scaling. Three points are generated.
<pre>
x <- rowMeans(v$E)


Pasilla data. Note that the bam files are not clear where to find them. According to the [https://support.bioconductor.org/p/50162/ message], we can download SAM files first and then convert them to BAM files by samtools (Not verify yet).
# y = residual standard deviation per gene
fit <- lmFit(v$E, design)
residuals <- v$E - fit$coef %*% t(design)  # or residuals(fit)
y <- apply(residuals, 1, sd)
 
# now you have the points for the voom plot
plot(x, y)
</pre>
<li>Inspect TMM+voom expression matrix. Note the '''weight matrix are almost sample dependent'''.
<pre>
<pre>
samtools view -h -o outputFile.bam inputFile.sam
names(v)
# [1] "targets" "E"      "weights" "design"
v$E        # log2 CPMs after TMM
#        Sample1  Sample2  Sample3  Sample4
# Gene1 16.96162 17.12378 15.83177 16.09242
# Gene2 17.92686 18.15234 20.14686 19.99371
# Gene3 18.50004 18.31281 17.41194 17.45798
v$weights  # precision weights
#          [,1]    [,2]    [,3]    [,4]
# [1,] 42.44895 42.44895 93.58325 93.51160
# [2,] 42.44895 42.44895 53.83541 53.83541
# [3,] 42.44895 42.44895 53.83541 53.83541
</pre>
</pre>
Note that 1) samples 1 and 2 have lower counts -> they have lower weights, and 2) voom computes precision weights for each observation (gene × sample) based on how far a particular sample’s residual is from the trend.


A modified R code that works is
Verify log2(CPM). Method 1: use cpm()
<pre>
logCPM <- cpm(dge, log=TRUE, prior.count=1) # prior.count avoids log(0)
logCPM
#        Sample1  Sample2  Sample3  Sample4
# Gene1 16.91861 17.08974 15.84947 16.10682
# Gene2 17.91216 18.14268 20.14552 19.99249
# Gene3 18.49497 18.30559 17.41632 17.46215
</pre>
Verify log2(CPM). Method 2: by hand ('''effective library size per sample''')
<pre>
<pre>
###################################################
# effective library size per sample (vector)
### code chunk number 11: gff (eval = FALSE)
eff.libsize <- dge$samples$lib.size * dge$samples$norm.factors
###################################################
 
library(rtracklayer)
# compute CPM manually: divide each column of counts by corresponding eff.libsize
fl <- paste0("ftp://ftp.ensembl.org/pub/release-62/",
cpm_manual <- sweep(counts, 2, eff.libsize, "/") * 1e6
            "gtf/drosophila_melanogaster/",
            "Drosophila_melanogaster.BDGP5.25.62.gtf.gz")
gffFile <- file.path(tempdir(), basename(fl))
download.file(fl, gffFile)
gff0 <- import(gffFile, asRangedData=FALSE)


###################################################
# log2 CPM with prior.count = 1
### code chunk number 12: gff_parse (eval = FALSE)
log2CPM_manual <- log2(cpm_manual + 1)
###################################################
log2CPM_manual
idx <- mcols(gff0)$source == "protein_coding" &
#       Sample1  Sample2  Sample3  Sample4
          mcols(gff0)$type == "exon" &
# Gene1 16.90889 17.08147 15.82544 16.08728
           seqnames(gff0) == "4"
# Gene2 17.90888 18.14036 20.14734 19.99415
gff <- gff0[idx]
# Gene3 18.49384 18.30386 17.41038 17.45650
## adjust seqnames to match Bam files
</pre>
seqlevels(gff) <- paste("chr", seqlevels(gff), sep="")
<li>Next step: DE analysis
chr4genes <- split(gff, mcols(gff)$gene_id)
<pre>
fit <- lmFit(v, design)
fit <- eBayes(fit)
topTable(fit, coef="groupB")
#           logFC  AveExpr        t      P.Value    adj.P.Val        B
# Gene2  2.0306865 19.05494 13.711164 9.354653e-06 2.806396e-05 86.19536
# Gene1 -1.0806544 16.50240 -8.093091 1.908026e-04 2.862040e-04 25.02757
# Gene3 -0.9714666 17.92069 -6.559327 6.012746e-04 6.012746e-04 13.90828
</pre>
</ul>
 
=== Within-subject correlation ===
* [https://support.bioconductor.org/p/9152932/ Does this RNAseq experiment require a repeated measures approach?]
** Solution 1: 9.7 Multi-level Experiments of LIMMA user guide. '''duplicateCorrelation()''', '''lmFit()''', '''makeContrasts()''', '''contrasts.fit()''' and '''eBayes()'''
** Solution 2: Section 3.5 "Comparisons both between and within subjects" in edgeR. model.matrix(), glmQLFit(), glmQLFTtest(), topTags().


###################################################
=== Time Course Experiments ===
### code chunk number 12: gff_parse (eval = FALSE)
* See Limma's [https://bioconductor.org/packages/release/bioc/vignettes/limma/inst/doc/usersguide.pdf#page=48 vignette] on Section 9.6
###################################################
** Few time points (ANOVA, contrast)
library(GenomicAlignments)
*** Which genes respond at either the 6 hour or 24 hour times in the wild-type?
*** Which genes respond (i.e., change over time) in the mutant?
*** Which genes respond differently over time in the mutant relative to the wild-type?
** Many time points (regression such as cubic spline,  moderated F-test)
*** Detect genes with different time trends for treatment vs control.


# fls <- c("untreated1_chr4.bam", "untreated3_chr4.bam")
== [https://bioconductor.org/packages/release/bioc/html/easyRNASeq.html easyRNASeq] ==
fls <- list.files(system.file("extdata", package="pasillaBamSubset"),
Calculates the coverage of high-throughput short-reads against a genome of reference and summarizes it per feature of interest (e.g. exon, gene, transcript). The data can be normalized as 'RPKM' or by the 'DESeq' or 'edgeR' package.
    recursive=TRUE, pattern="*bam$", full=TRUE)
path <- system.file("extdata", package="pasillaBamSubset")
bamlst <- BamFileList(fls)
genehits <- summarizeOverlaps(chr4genes, bamlst, mode="Union") # SummarizedExperiment object
assays(genehits)$counts


###################################################
== ShortRead ==
### code chunk number 15: pasilla_exoncountset (eval = FALSE)
Base classes, functions, and methods for representation of high-throughput, short-read sequencing data.
###################################################
library(DESeq)


expdata = MIAME(
== [http://www.bioconductor.org/packages/release/bioc/html/Rsamtools.html Rsamtools] ==
              name="pasilla knockdown",
The Rsamtools package provides an interface to BAM files.  
              lab="Genetics and Developmental Biology, University of
                  Connecticut Health Center",
              contact="Dr. Brenton Graveley",
              title="modENCODE Drosophila pasilla RNA Binding Protein RNAi
                  knockdown RNA-Seq Studies",
              pubMedIds="20921232",
              url="http://www.ncbi.nlm.nih.gov/projects/geo/query/acc.cgi?acc=GSE18508",
              abstract="RNA-seq of 3 biological replicates of from the Drosophila
                  melanogaster S2-DRSC cells that have been RNAi depleted of mRNAs
                  encoding pasilla, a mRNA binding protein and 4 biological replicates
                  of the the untreated cell line.")


design <- data.frame(
The main purpose of the Rsamtools package is to import BAM files into R. Rsamtools also provides some facility for file access such as record counting, index file creation, and filtering to create new files containing subsets of the original. An important use case for Rsamtools is as a starting point for creating R objects suitable for a diversity of work flows, e.g., AlignedRead objects in the ShortRead package (for quality assessment and read manipulation), or GAlignments objects in GenomicAlignments package (for RNA-seq and other applications). Those desiring more functionality are encouraged to explore samtools and related software efforts
              condition=c("untreated", "untreated"),
              replicate=c(1,1),
              type=rep("single-read", 2), stringsAsFactors=TRUE)
library(DESeq)
geneCDS <- newCountDataSet(
                  countData=assay(genehits),
                  conditions=design)


experimentData(geneCDS) <- expdata
This package provides an interface to the 'samtools', 'bcftools', and 'tabix' utilities (see 'LICENCE') for manipulating SAM (Sequence Alignment / Map), FASTA, binary variant call (BCF) and compressed indexed tab-delimited (tabix) files.
sampleNames(geneCDS) = colnames(genehits)


###################################################
== [http://www.bioconductor.org/packages/release/bioc/html/IRanges.html IRanges] ==
### code chunk number 16: pasilla_genes (eval = FALSE)
IRanges is a fundamental package (see how many packages depend on it) to other packages like '''GenomicRanges''', '''GenomicFeatures''' and '''GenomicAlignments'''. The package defines the IRanges class.
###################################################
chr4tx <- split(gff, mcols(gff)$transcript_id)
txhits <- summarizeOverlaps(chr4tx, bamlst)
txCDS <- newCountDataSet(assay(txhits), design)
experimentData(txCDS) <- expdata
</pre>


We can also check out ?summarizeOverlaps to find some fake examples.
The '''plotRanges'''() function given in the 'An Introduction to IRanges' vignette shows how to draw an IRanges object.


== tidybulk ==
If we want to make the same plot using the ggplot2 package, we can follow the example in [http://stackoverflow.com/questions/21506724/how-to-plot-overlapping-ranges-with-ggplot2 this post]. Note that disjointBins() returns a vector the bin number for each bins counting on the y-axis.
* https://bioconductor.org/packages/release/bioc/html/tidybulk.html
* [https://stemangiola.github.io/bioc_2020_tidytranscriptomics/articles/tidytranscriptomics.html A Tidy Transcriptomics introduction to RNA-Seq analyses]


== Bisque ==
=== flank ===
[https://github.com/cozygene/bisque?s=09 Bisque]: An R toolkit for accurate and efficient estimation of cell composition ('decomposition') from bulk expression data with single-cell information.
The example is obtained from ?IRanges::flank.
<pre>
ir3 <- IRanges(c(2,5,1), c(3,7,3))
# IRanges of length 3
#    start end width
# [1]    2  3    2
# [2]    5  7    3
# [3]    1  3    3


== [https://cran.r-project.org/web/packages/chromoMap/ chromoMap] ==
flank(ir3, 2)
#    start end width
# [1]    0  1    2
# [2]    3  4    2
# [3]    -1  0    2
# Note: by default flank(ir3, 2) = flank(ir3, 2, start = TRUE, both=FALSE)
# For example, [2,3] => [2,X] => (..., 0, 1, 2) => [0, 1]
#                                    == ==


== [http://bioconductor.org/packages/release/bioc/html/Rsubread.html Rsubread] ==
flank(ir3, 2, start=FALSE)
See [https://support.bioconductor.org/p/65604/ this post] for about C version of the [http://bioinf.wehi.edu.au/featureCounts/ featureCounts] program.
#    start end width
# [1]    4  5    2
# [2]    8  9    2
# [3]     4  5    2
# For example, [2,3] => [X,3] => (..., 3, 4, 5) => [4,5]
#                                        == ==


[https://www.biostars.org/p/96176/ featureCounts vs HTSeq-count]
flank(ir3, 2, start=c(FALSE, TRUE, FALSE))
#    start end width
# [1]    4  5    2
# [2]    3  4    2
# [3]    4  5    2
# Combine the ideas of the previous 2 cases.


[http://bioinformatics.cvr.ac.uk/blog/featurecounts-or-htseq-count/ featureCounts or htseq-count?]
flank(ir3, c(2, -2, 2))
#    start end width
# [1]    0  1    2
# [2]    5  6    2
# [3]    -1  0    2
# The original statement is the same as flank(ir3, c(2, -2, 2), start=T, both=F)
# For example, [5, 7] => [5, X] => ( 5, 6) => [5, 6]
#                                  == ==


== Inference ==
flank(ir3, -2, start=F)
* [https://academic.oup.com/bioinformatics/advance-article/doi/10.1093/bioinformatics/btz089/5307752 How well do RNA-Seq differential gene expression tools perform in a complex eukaryote? A case study in A. thaliana] Froussios, Bioinformatics 2019
#    start end width
# [1]    2  3    2
# [2]    6  7    2
# [3]    2  3    2
# For example, [5, 7] => [X, 7] => (..., 6, 7) => [6, 7]
#                                      == ==
 
flank(ir3, 2, both = TRUE)
#    start end width
# [1]    0  3    4
# [2]    3  6    4
# [3]    -1  2    4
# The original statement is equivalent to flank(ir3, 2, start=T, both=T)
# (From the manual) If both = TRUE, extends the flanking region width positions into the range.  
#        The resulting range thus straddles the end point, with width positions on either side.
# For example, [2, 3] => [2, X] => (..., 0, 1, 2, 3) => [0, 3]
#                                            ==
#                                      == == == ==
 
flank(ir3, 2, start=FALSE, both=TRUE)
#    start end width
# [1]    2  5    4
# [2]    6  9    4
# [3]    2  5    4
# For example, [2, 3] => [X, 3] => (..., 2, 3, 4, 5) => [4, 5]
#                                          ==
#                                      == == == ==


=== tximport ===
* [http://bioconductor.org/packages/release/bioc/vignettes/tximport/inst/doc/tximport.html#Downstream_DGE_in_Bioconductor Vignette]. Search "offset".
* [https://f1000research.com/articles/4-1521 Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences] by Soneson, et al. F1000Research. Open peer review.
** [https://f1000researchdata.s3.amazonaws.com/datasets/7563/e22fa771-ee2b-486a-8cf4-31b645163d6b_gse64570_quantification.html#definition-of-gene-to-transcript-mapping GSE64570]
** [https://f1000researchdata.s3.amazonaws.com/datasets/7563/080b3afa-c02e-407a-b08b-3a1e84aff2db_gse69244_quantification.html GSE69244]
** [https://f1000researchdata.s3.amazonaws.com/datasets/7563/3ca97d58-f9bb-48e4-9e76-85d92f21f40a_GSE72165_quantification.html GSE72165]
<ul>
<li>http://bioconductor.org/packages/release/bioc/html/tximport.html
<pre>
$ head -5 quant.sf
Name Length EffectiveLength TPM NumReads
ENST00000456328.2 1657 1410.79 0.083908 2.46885
ENST00000450305.2 632 410.165 0 0
ENST00000488147.1 1351 1035.94 10.4174 225.073
ENST00000619216.1 68 24 0 0
ENST00000473358.1 712 453.766 0 0
</pre>
</pre>
</li>
<li>Another real data from [https://pdmdb.cancer.gov/web/apex/f?p=101:34:::NO:34:: PDMR -> PDX]. Select Genomic Analysis -> RNASeq and TPM(genes) column. Consider Patient ID=114348, Specimen ID=004-R, Sample ID=ATHY22, CTEP SDC Code=10038045,
{{Pre}}
$ head -2 114348_004-R_ATHY22_v2.0.1.4.0_RNASeq.RSEM.genes.results
gene_id transcript_id.s. length effective_length  expected_count  TPM   FPKM
5S_rRNA uc021ofx.1 105.04 2.23           2039.99   49629.87 35353.97


$ R
Both IRanges and GenomicRanges packages provide the '''flank''' function.
x = read.delim("114348_004-R_ATHY22_v2.0.1.4.0_RNASeq.RSEM.genes.results")
 
dim(x)
'''Flanking region''' is also a common term in High-throughput sequencing. The [http://www.broadinstitute.org/igv/book/export/html/6 IGV] user guide also has some option related to flanking.
# [1] 28109    7
* General tab: '''Feature flanking regions (base pairs)'''. IGV adds the flank before and after a feature locus when you zoom to a feature, or when you view gene/loci lists in multiple panels.
names(x)
* Alignments tab: '''Splice junction track options'''. The minimum amount of nucleotide coverage required on both sides of a junction for a read to be associated with the junction. This affects the coverage of displayed junctions, and the display of junctions covered only by reads with small flanking regions.
# [1] "gene_id"          "transcript_id.s." "length"          "effective_length"
 
# [5] "expected_count"  "TPM"              "FPKM"           
== [https://www.bioconductor.org/packages/release/bioc/html/Biostrings.html Biostrings] ==
x[1:3, -2]
* [http://www.r-exercises.com/2017/05/21/manipulate-biological-data-using-biostrings-package-part-1/ Manipulate Biological Data Using Biostrings Package Exercises (Part 1)]
#    gene_id length effective_length expected_count      TPM    FPKM
* [http://www.r-exercises.com/2017/05/28/manipulate-biological-data-using-biostrings-package-exercises-part-2/ Manipulate Biological Data Using Biostrings Package Exercises (Part 2)] - it covers global, local & overlap alignments.
# 1  5S_rRNA 105.04            2.23        2039.99 49629.87 35353.97
# 2 5_8S_rRNA 161.00            21.19          0.00    0.00    0.00
# 3    6M1-18 473.00          302.74          0.00    0.00    0.00


y <- read.delim("114348_004-R_ATHY22_v2.0.1.4.0_RNASeq.RSEM.isoforms.results")
== [http://www.bioconductor.org/packages/release/bioc/html/GenomicRanges.html GenomicRanges] ==
dim(y)
GenomicRanges depends on [http://www.bioconductor.org/packages/release/bioc/html/IRanges.html IRanges] package. See the dependency diagram below.
# [1] 78375    8
<pre>
names(y)
GenomicFeatues ------- GenomicRanges -+- IRanges -- BioGenomics
# [1] "transcript_id"    "gene_id"          "length"          "effective_length"
                        |            +
# [5] "expected_count"  "TPM"              "FPKM"            "IsoPct"
                  +-----+            +- GenomeInfoDb
y[1:3, -1]
                  |                      |
#  gene_id length effective_length expected_count TPM FPKM IsoPct
GenomicAlignments  +--- Rsamtools --+-----+
# 1 5S_rRNA    110            3.06              0  0    0      0
                                    +--- Biostrings
# 2 5S_rRNA    133            9.08              0  0    0      0
# 3 5S_rRNA    92            0.00              0  0    0      0
</pre>
</pre>
</li>
</ul>


[[:File:RSEM PDX.png]]
The package defines some classes
 
* GRanges
=== DESeq or edgeR ===
* GRangesList
* [http://genomebiology.com/2014/15/12/550#sec4 DESeq2 method]
* GAlignments
* DESeq2 with a large number of samples -> use DESEq2 to normalize the data and then use do a Wilcoxon rank-sum test on the normalized counts, for each gene separately, or, even better, use a permutation test. See [https://support.bioconductor.org/p/60432/ this post]. Or consider the limma-voom method instead, which will handle 1000 samples in a few seconds without the need for extra memory.
* SummarizedExperiment: it has the following slots - expData, rowData, colData, and assays. Accessors include assays(), assay(), colData(), expData(), mcols(), ... The mcols() method is defined in the S4Vectors package.
* edgeR normalization factor [https://support.bioconductor.org/p/65683/ post]. Normalization factors are computed using the trimmed mean of M-values (TMM) method; see the [http://genomebiology.com/2010/11/3/r25 paper by Robinson & Oshlack 2010] for more details. Briefly, M-values are defined as the library size-adjusted log-ratio of counts between two libraries. The most extreme 30% of M-values are trimmed away, and the mean of the remaining M-values is computed. This trimmed mean represents the log-normalization factor between the two libraries. The idea is to eliminate systematic differences in the counts between libraries, by assuming that most genes are not DE.
* edgeR [http://f1000research.com/articles/5-1438/v1 From reads to genes to pathways: differential expression analysis of RNA-Seq experiments using Rsubread and the edgeR quasi-likelihood pipeline]
* [https://support.bioconductor.org/p/65890/ Can I feed TCGA normalized count data to EdgeR?]
* [https://support.bioconductor.org/p/66067/ counts() function and normalized counts].
* [https://support.bioconductor.org/p/74572/ Why use Negative binomial distribution] in RNA-Seq data?] and the [http://www.bioconductor.org/help/course-materials/2015/CSAMA2015/lect/L05-deseq2-anders.pdf Presentation] by Simon Anders.
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-017-1803-9 XBSeq2] – a fast and accurate quantification of differential expression and differential polyadenylation. By using simulated datasets, they demonstrated that, overall, XBSeq2 performs equally well as XBSeq in terms of several statistical metrics and both perform better than DESeq2 and edgeR.
* [https://www.biorxiv.org/content/early/2018/08/27/399931 DEBrowser: Interactive Differential Expression Analysis and Visualization Tool for Count Data] Alper Kucukural 2018
* [https://genomespot.blogspot.com/2020/10/edger-or-deseq2-comparing-performance.html?s=09 EdgeR or DESeq2? Comparing the performance of differential expression tools]


=== Generalized Linear Models and Plots with edgeR ===
(As of Jan 6, 2015) The introduction in GenomicRanges vignette mentions the ''GAlignments'' object created from a 'BAM' file discarding some information such as SEQ field, QNAME field, QUAL, MAPQ and any other information that is not needed in its document. This means that multi-reads don't receive any special treatment. Also pair-end reads will be treated as single-end reads and the pairing information will be lost. This might change in the future.
[https://morphoscape.wordpress.com/2020/09/26/generalized-linear-models-and-plots-with-edger-advanced-differential-expression-analysis/ Generalized Linear Models and Plots with edgeR – Advanced Differential Expression Analysis]


=== [http://www.bioconductor.org/packages/devel/bioc/html/EBSeq.html EBSeq] ===
== [http://www.bioconductor.org/packages/release/bioc/html/GenomicAlignments.html GenomicAlignments] ==
An R package for gene and isoform differential expression analysis of RNA-seq data
=== Counting reads with summarizeOverlaps vignette ===
<pre>
library(GenomicAlignments)
library(DESeq)
library(edgeR)


http://www.rna-seqblog.com/analysis-of-ebv-transcription-using-high-throughput-rna-sequencing/
fls <- list.files(system.file("extdata", package="GenomicAlignments"),
    recursive=TRUE, pattern="*bam$", full=TRUE)


=== [http://www.bioconductor.org/packages/release/bioc/html/prebs.html prebs] ===
features <- GRanges(
Probe region expression estimation for RNA-seq data for improved microarray comparability
    seqnames = c(rep("chr2L", 4), rep("chr2R", 5), rep("chr3L", 2)),
 
    ranges = IRanges(c(1000, 3000, 4000, 7000, 2000, 3000, 3600, 4000,
=== [http://www.bioconductor.org/packages/release/bioc/html/DEXSeq.html DEXSeq] ===
        7500, 5000, 5400), width=c(rep(500, 3), 600, 900, 500, 300, 900,
Inference of differential exon usage in RNA-Seq
        300, 500, 500)), "-",
    group_id=c(rep("A", 4), rep("B", 5), rep("C", 2)))
features


=== [http://www-personal.umich.edu/~jianghui/rseqnp/ rSeqNP] ===
# GRanges object with 11 ranges and 1 metadata column:
A non-parametric approach for detecting differential expression and splicing from RNA-Seq data
#      seqnames      ranges strand  |    group_id
#          <Rle>    <IRanges>  <Rle>  | <character>
#  [1]    chr2L [1000, 1499]      -  |          A
#  [2]    chr2L [3000, 3499]      -  |          A
#  [3]    chr2L [4000, 4499]      -  |          A
#  [4]    chr2L [7000, 7599]      -  |          A
#  [5]    chr2R [2000, 2899]      -   |          B
#  ...      ...          ...    ... ...        ...
#  [7]   chr2R [3600, 3899]      -  |          B
#  [8]    chr2R [4000, 4899]      -  |          B
#  [9]    chr2R [7500, 7799]      -  |          B
#  [10]    chr3L [5000, 5499]      -  |          C
#  [11]    chr3L [5400, 5899]      -  |          C
#  -------
#  seqinfo: 3 sequences from an unspecified genome; no seqlengths
olap
# class: SummarizedExperiment
# dim: 11 2
# exptData(0):
# assays(1): counts
# rownames: NULL
# rowData metadata column names(1): group_id
# colnames(2): sm_treated1.bam sm_untreated1.bam
# colData names(0):


=== [https://peerj.com/articles/3890/ voomDDA]: discovery of diagnostic biomarkers and classification of RNA-seq data ===
assays(olap)$counts
http://www.biosoft.hacettepe.edu.tr/voomDDA/
#      sm_treated1.bam sm_untreated1.bam
#  [1,]              0                0
#  [2,]              0                0
#  [3,]              0                0
#  [4,]              0                0
#  [5,]              5                1
#  [6,]              5                0
[7,]              2                0
#  [8,]            376              104
#  [9,]              0                0
# [10,]              0                0
# [11,]               0                0
</pre>


== Pathway analysis ==
Pasilla data. Note that the bam files are not clear where to find them. According to the [https://support.bioconductor.org/p/50162/ message], we can download SAM files first and then convert them to BAM files by samtools (Not verify yet).
 
=== About the KEGG pathways ===
* [https://www.gsea-msigdb.org/gsea/msigdb/collections.jsp#C2 MSigDB] database or msigdbr package - seems to be old. It only has 186 KEGG pathways for human.
<ul>
<li>[http://www.bioconductor.org/packages/release/bioc/html/KEGGREST.html KEGGREST] package directly pull the data from kegg.jp. I can get 337 KEGG pathways for human ('hsa')
<pre>
<pre>
BiocManager::install("KEGGREST")
samtools view -h -o outputFile.bam inputFile.sam
library(KEGGREST)
res <- keggList("pathway", "hsa")
length(res) # 337
</pre>
</pre>
</li>
</ul>


=== GSOAP ===
A modified R code that works is
[https://academic.oup.com/bioinformatics/article/36/9/2923/5715574 GSOAP: a tool for visualization of gene set over-representation analysis]
<pre>
 
###################################################
=== clusterProfiler ===
### code chunk number 11: gff (eval = FALSE)
* [https://bioconductor.org/packages/release/bioc/html/clusterProfiler.html clusterProfiler]
###################################################
* [http://yulab-smu.top/clusterProfiler-book/chapter6.html#kegg-gene-set-enrichment-analysis Chapter 6 KEGG analysis]
library(rtracklayer)
fl <- paste0("ftp://ftp.ensembl.org/pub/release-62/",
            "gtf/drosophila_melanogaster/",
            "Drosophila_melanogaster.BDGP5.25.62.gtf.gz")
gffFile <- file.path(tempdir(), basename(fl))
download.file(fl, gffFile)
gff0 <- import(gffFile, asRangedData=FALSE)


=== [http://bioconductor.org/packages/release/bioc/html/fgsea.html fgsea:] Fast Gene Set Enrichment Analysis ===
###################################################
* [https://bioinformatics.stackexchange.com/a/166 Are fgsea and Broad Institute GSEA equivalent?]. Note that enrichment score are the same though the way of calculating p-values can be different.
### code chunk number 12: gff_parse (eval = FALSE)
* [https://stephenturner.github.io/deseq-to-fgsea/ DESeq results to pathways in 60 Seconds with the fgsea package]
###################################################
* [https://mgrcbioinfo.github.io/my_GSEA_plot/ GSEA plot for multiple comparisons]
idx <- mcols(gff0)$source == "protein_coding" &
* [https://davetang.org/muse/2018/01/10/using-fast-preranked-gene-set-enrichment-analysis-fgsea-package/ Using the fast preranked gene set enrichment analysis (fgsea) package] 2018
          mcols(gff0)$type == "exon" &
          seqnames(gff0) == "4"
gff <- gff0[idx]
## adjust seqnames to match Bam files
seqlevels(gff) <- paste("chr", seqlevels(gff), sep="")
chr4genes <- split(gff, mcols(gff)$gene_id)


=== [http://bioconductor.org/packages/release/bioc/html/GSEABenchmarkeR.html GSEABenchmarkeR]: Reproducible GSEA Benchmarking ===
###################################################
[https://www.biorxiv.org/content/10.1101/674267v1 Towards a gold standard for benchmarking gene set enrichment analysis]
### code chunk number 12: gff_parse (eval = FALSE)
###################################################
library(GenomicAlignments)


=== hypeR ===
# fls <- c("untreated1_chr4.bam", "untreated3_chr4.bam")
* [https://academic.oup.com/bioinformatics/article/36/4/1307/5566242 hypeR: an R package for geneset enrichment workflows]
fls <- list.files(system.file("extdata", package="pasillaBamSubset"),
* [https://montilab.github.io/hypeR-workshop/ Efficient, Scalable, and Reproducible Enrichment Workflows] from [https://bioc2020.bioconductor.org/workshops.html Bioc2020]
    recursive=TRUE, pattern="*bam$", full=TRUE)
path <- system.file("extdata", package="pasillaBamSubset")
bamlst <- BamFileList(fls)
genehits <- summarizeOverlaps(chr4genes, bamlst, mode="Union") # SummarizedExperiment object
assays(genehits)$counts


=== [https://bioconductor.org/packages/release/bioc/html/rgsepd.html GSEPD] ===
###################################################
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2697-5 GSEPD: a Bioconductor package for RNA-seq gene set enrichment and projection display]
### code chunk number 15: pasilla_exoncountset (eval = FALSE)
###################################################
library(DESeq)


=== SeqGSEA ===
expdata = MIAME(
http://www.bioconductor.org/packages/release/bioc/html/SeqGSEA.html
              name="pasilla knockdown",
              lab="Genetics and Developmental Biology, University of
                  Connecticut Health Center",
              contact="Dr. Brenton Graveley",
              title="modENCODE Drosophila pasilla RNA Binding Protein RNAi
                  knockdown RNA-Seq Studies",
              pubMedIds="20921232",
              url="http://www.ncbi.nlm.nih.gov/projects/geo/query/acc.cgi?acc=GSE18508",
              abstract="RNA-seq of 3 biological replicates of from the Drosophila
                  melanogaster S2-DRSC cells that have been RNAi depleted of mRNAs
                  encoding pasilla, a mRNA binding protein and 4 biological replicates
                  of the the untreated cell line.")


=== BAGSE ===
design <- data.frame(
[https://academic.oup.com/bioinformatics/article/36/6/1689/5614816 BAGSE: a Bayesian hierarchical model approach for gene set enrichment analysis] 2020
              condition=c("untreated", "untreated"),
 
              replicate=c(1,1),
=== GeneSetCluster ===
              type=rep("single-read", 2), stringsAsFactors=TRUE)
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-03784-z GeneSetCluster: a tool for summarizing and integrating gene-set analysis results]
library(DESeq)
geneCDS <- newCountDataSet(
                  countData=assay(genehits),
                  conditions=design)


== Pipeline ==
experimentData(geneCDS) <- expdata
sampleNames(geneCDS) = colnames(genehits)


=== SPEAQeasy ===
###################################################
[https://rna-seqblog.com/speaqeasy-a-scalable-pipeline-for-expression-analysis-and-quantification-for-r-bioconductor-powered-rna-seq-analyses/ SPEAQeasy] – a scalable pipeline for expression analysis and quantification for R/Bioconductor-powered RNA-seq analyses
### code chunk number 16: pasilla_genes (eval = FALSE)
###################################################
chr4tx <- split(gff, mcols(gff)$transcript_id)
txhits <- summarizeOverlaps(chr4tx, bamlst)
txCDS <- newCountDataSet(assay(txhits), design)
experimentData(txCDS) <- expdata
</pre>


=== Nextflow ===
We can also check out ?summarizeOverlaps to find some fake examples.
* [https://www.nextflow.io/ Nextflow]: Data-driven computational pipelines, [https://www.nextflow.io/blog.html Blog].
* [https://www.nextflow.io/example4.html RNA-Seq pipeline]


=== GeneTEFlow ===
== tidybulk ==
[https://rna-seqblog.com/geneteflow-a-nextflow-based-pipeline-for-analysing-gene-and-transposable-elements-expression-from-rna-seq-data/ GeneTEFlow] – A Nextflow-based pipeline for analysing gene and transposable elements expression from RNA-Seq data
* [https://bioconductor.org/packages/release/bioc/html/tidybulk.html tidybulk]: an R tidy framework for modular transcriptomic data analysis, [https://genomebiology.biomedcentral.com/articles/10.1186/s13059-020-02233-7 paper]
* [https://stemangiola.github.io/bioc_2020_tidytranscriptomics/articles/tidytranscriptomics.html A Tidy Transcriptomics introduction to RNA-Seq analyses]


=== pipeComp ===
== Bisque ==
[https://github.com/plger/pipeComp/ pipeComp], a general framework for the evaluation of computational pipelines, reveals performant single-cell RNA-seq preprocessing tools
[https://github.com/cozygene/bisque?s=09 Bisque]: An R toolkit for accurate and efficient estimation of cell composition ('decomposition') from bulk expression data with single-cell information.


=== [https://github.com/PF2-pasteur-fr/SARTools SARTools] ===
== [https://cran.r-project.org/web/packages/chromoMap/ chromoMap] ==
http://www.rna-seqblog.com/sartools-a-deseq2-and-edger-based-r-pipeline-for-comprehensive-differential-analysis-of-rna-seq-data/


=== SEQprocess ===
== Inference ==
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2676-x SEQprocess]: a modularized and customizable pipeline framework for NGS processing in R package
* [https://academic.oup.com/bioinformatics/advance-article/doi/10.1093/bioinformatics/btz089/5307752 How well do RNA-Seq differential gene expression tools perform in a complex eukaryote? A case study in A. thaliana] Froussios, Bioinformatics 2019


== pasilla and pasillaBamSubset Data ==
=== tximport ===
pasilla - Data package with per-exon and per-gene read counts of RNA-seq samples of Pasilla knock-down by Brooks et al., Genome Research 2011.
* [http://bioconductor.org/packages/release/bioc/vignettes/tximport/inst/doc/tximport.html#Downstream_DGE_in_Bioconductor Vignette]. Search "offset".
* [https://f1000research.com/articles/4-1521 Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences] by Soneson, et al. [https://f1000research.com/gateways/bioconductor F1000Research]. Open peer review.
** [https://f1000researchdata.s3.amazonaws.com/datasets/7563/e22fa771-ee2b-486a-8cf4-31b645163d6b_gse64570_quantification.html#definition-of-gene-to-transcript-mapping GSE64570]
** [https://f1000researchdata.s3.amazonaws.com/datasets/7563/080b3afa-c02e-407a-b08b-3a1e84aff2db_gse69244_quantification.html GSE69244]
** [https://f1000researchdata.s3.amazonaws.com/datasets/7563/3ca97d58-f9bb-48e4-9e76-85d92f21f40a_GSE72165_quantification.html GSE72165]
<ul>
<li>http://bioconductor.org/packages/release/bioc/html/tximport.html
<pre>
$ head -5 quant.sf
Name Length EffectiveLength TPM NumReads
ENST00000456328.2 1657 1410.79 0.083908 2.46885
ENST00000450305.2 632 410.165 0 0
ENST00000488147.1 1351 1035.94 10.4174 225.073
ENST00000619216.1 68 24 0 0
ENST00000473358.1 712 453.766 0 0
</pre>
</li>
<li>Another real data from [https://pdmdb.cancer.gov/web/apex/f?p=101:34:::NO:34:: PDMR -> PDX]. Select Genomic Analysis -> RNASeq and TPM(genes) column. Consider Patient ID=114348, Specimen ID=004-R, Sample ID=ATHY22, CTEP SDC Code=10038045,
{{Pre}}
$ head -2 114348_004-R_ATHY22_v2.0.1.4.0_RNASeq.RSEM.genes.results
gene_id transcript_id.s. length effective_length  expected_count  TPM   FPKM
5S_rRNA uc021ofx.1 105.04 2.23           2039.99   49629.87 35353.97


pasillaBamSubset - Subset of BAM files untreated1.bam (single-end reads) and untreated3.bam (paired-end reads) from "Pasilla" experiment (Pasilla knock-down by Brooks et al., Genome Research 2011).
$ R
 
x = read.delim("114348_004-R_ATHY22_v2.0.1.4.0_RNASeq.RSEM.genes.results")
== [http://www.bioconductor.org/packages/release/bioc/html/BitSeq.html BitSeq] ==
dim(x)
Transcript expression inference and differential expression analysis for RNA-seq data. The homepage of [http://www.hiit.fi/u/ahonkela/ Antti Honkela].
# [1] 28109    7
 
names(x)
== ReportingTools ==
# [1] "gene_id"         "transcript_id.s." "length"          "effective_length"
The [http://www.bioconductor.org/packages/release/bioc/html/ReportingTools.html ReportingTools] software package enables users to easily display reports of analysis results generated from sources such as microarray and sequencing data.
# [5] "expected_count"  "TPM"              "FPKM"           
x[1:3, -2]
#    gene_id length effective_length expected_count      TPM    FPKM
# 1  5S_rRNA 105.04            2.23        2039.99 49629.87 35353.97
# 2 5_8S_rRNA 161.00            21.19          0.00    0.00    0.00
# 3    6M1-18 473.00          302.74          0.00    0.00    0.00


Figures can be included in a cell in output table. See [http://www.bioconductor.org/packages/release/bioc/vignettes/ReportingTools/inst/doc/microarrayAnalysis.pdf#page=3 Using ReportingTools in an Analysis of Microarray Data].
y <- read.delim("114348_004-R_ATHY22_v2.0.1.4.0_RNASeq.RSEM.isoforms.results")
dim(y)
# [1] 78375    8
names(y)
# [1] "transcript_id"    "gene_id"          "length"          "effective_length"
# [5] "expected_count"  "TPM"              "FPKM"            "IsoPct"
y[1:3, -1]
#  gene_id length effective_length expected_count TPM FPKM IsoPct
# 1 5S_rRNA    110            3.06              0  0    0      0
# 2 5S_rRNA    133            9.08              0  0    0      0
# 3 5S_rRNA    92            0.00              0  0    0      0
</pre>
</li>
</ul>


It is suggested by e.g. EnrichmentBrowser.
[[:File:RSEM PDX.png]]


== [http://cran.r-project.org/web/packages/sequences/index.html sequences] ==
=== DESeq2 or edgeR ===
More or less an educational package. It has 2 c and c++ source code. It is used in Advanced R programming and package development.
* [http://genomebiology.com/2014/15/12/550#sec4 DESeq2 method]
 
* [https://biocorecrg.github.io/PHINDaccess_RNAseq_2020/differential_expression.html DESeq2 steps]
== [http://www.bioconductor.org/packages/release/bioc/html/QuasR.html QuasR] ==
** DESeq2 uses the median of ratio method for normalization: briefly, the counts are divided by sample-specific size factors.
[http://bioinformatics.oxfordjournals.org/content/early/2014/12/09/bioinformatics.btu781.short?rss=1&ssource=mfr Bioinformatics] paper
** Four steps: 1. '''Geometric mean''' is calculated for each gene across all samples (length=number of genes vector). 2. '''ratios''': The counts for a gene in each sample is then divided by this mean. 3. The '''median of these (gene) ratios''' (aka size factor) in a sample is the size factor for that sample (length=number of samples). 4. the raw counts data is divided by these size factors sample by sample.
** [https://github.com/oxwang/fda_scRNA-seq/blob/master/3_Normalization/Code/HCC1395/10X_LLU.R#L148 Manual implementation]. The results (size factor values) are not the same as counts(dds, normalized = TRUE) returns? Ans: see the help of counts()
** [https://rdrr.io/bioc/DESeq2/man/counts.html counts()]. '''normalization factors''' is used by default  (''normalization factors'' always preempt ''size factors'')
** [https://rdrr.io/bioc/DESeq2/man/sizeFactors.html sizeFactors()] - sample by sample (a vector)
** [https://rdrr.io/bioc/DESeq2/man/normalizationFactors.html normalizationFactors()] - '''Gene-specific''' normalization factors for each sample (a matrix)
* DESeq2 with a large number of samples -> use DESEq2 to normalize the data and then use do a Wilcoxon rank-sum test on the normalized counts, for each gene separately, or, even better, use a permutation test. See [https://support.bioconductor.org/p/60432/ this post]. Or consider the limma-voom method instead, which will handle 1000 samples in a few seconds without the need for extra memory.
* edgeR normalization factor [https://support.bioconductor.org/p/65683/ post]. Normalization factors are computed using the trimmed mean of M-values (TMM) method; see the [http://genomebiology.com/2010/11/3/r25 paper by Robinson & Oshlack 2010] for more details. Briefly, M-values are defined as the library size-adjusted log-ratio of counts between two libraries. The most extreme 30% of M-values are trimmed away, and the mean of the remaining M-values is computed. This trimmed mean represents the log-normalization factor between the two libraries. The idea is to eliminate systematic differences in the counts between libraries, by assuming that most genes are not DE.
* edgeR [http://f1000research.com/articles/5-1438/v1 From reads to genes to pathways: differential expression analysis of RNA-Seq experiments using Rsubread and the edgeR quasi-likelihood pipeline]
* [https://support.bioconductor.org/p/65890/ Can I feed TCGA normalized count data to EdgeR?]
* [https://support.bioconductor.org/p/66067/ counts() function and normalized counts].
* [https://support.bioconductor.org/p/74572/ Why use Negative binomial distribution] in RNA-Seq data?] and the [http://www.bioconductor.org/help/course-materials/2015/CSAMA2015/lect/L05-deseq2-anders.pdf Presentation] by Simon Anders.
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-017-1803-9 XBSeq2] – a fast and accurate quantification of differential expression and differential polyadenylation. By using simulated datasets, they demonstrated that, overall, XBSeq2 performs equally well as XBSeq in terms of several statistical metrics and both perform better than DESeq2 and edgeR.
* [https://www.biorxiv.org/content/early/2018/08/27/399931 DEBrowser: Interactive Differential Expression Analysis and Visualization Tool for Count Data] Alper Kucukural 2018
* [https://genomespot.blogspot.com/2020/10/edger-or-deseq2-comparing-performance.html?s=09 EdgeR or DESeq2? Comparing the performance of differential expression tools]
* StatQuest:
** [https://youtu.be/Wdt6jdi-NQo edgeR, part 1, Library Normalization] (TMM),
** [https://youtu.be/UFB993xufUU DESeq2, part 1, Library Normalization]
** [https://youtu.be/Gi0JdrxRq5s edgeR and DESeq2, part 2 - Independent Filtering]
* [https://bioinformatics.chat/deseq2?s=09 Differential gene expression and DESeq2 with Michael Love (#60)]
* [https://morphoscape.wordpress.com/2022/08/09/downstream-bioinformatics-analysis-of-omics-data-with-edger/ Downstream Bioinformatics Analysis of Omics Data with edgeR]
 
==== Shrinkage estimators ====
<ul>
<li> The package uses a negative binomial statistical model to fit the count data, and can account for differences in sequencing depth across samples.
* Shrinkage is a technique used to '''regularize the estimates of the parameters''' of the negative binomial model.
* The idea behind shrinkage is to '''pull the estimated values of the parameters towards a prior distribution''', which can help to '''reduce the variability of the estimates''' and '''improve the stability of the results'''.
* The specific shrinkage method used in DESeq2 is called the "shrinkage prior for dispersion" method. This method involves '''adding a prior distribution on the dispersion parameter''' of the negative binomial model, which is used to control the degree of overdispersion in the data.
* This prior distribution is designed to '''shrink the estimated values of the dispersion parameter''' towards a common value across all the genes in the dataset, which can help to '''reduce the variance of the estimated log-fold changes'''.
<li>More details:
* The negative binomial model is used to model the count data, y, as a function of the '''mean''', <math>\mu</math>, and the '''dispersion''', <math>\alpha</math>. The probability mass function of the negative binomial is given by:
: <math>
\begin{align}
P(y | \mu, \alpha) = (y + \alpha - 1)! / (y! * (\alpha - 1)!) * (\mu / (\mu + \alpha))^y * (\alpha / (\mu + \alpha))^\alpha
\end{align}
</math>
* The likelihood of the data is given by:
: <math>
\begin{align}
L(\mu, \alpha | y) = \prod_i [ P(y_i | \mu_i, \alpha) ]
\end{align}
</math>
* The log-likelihood is :
: <math>
\begin{align}
logL(\mu, \alpha | y) = \sum_i [ \log(P(y_i | \mu_i, \alpha)) ]
\end{align}
</math>
: In this model, <math>\mu</math> is the mean of the negative binomial for each gene and it is modeled as a linear function of the design matrix.
: <math>
\begin{align}
\mu_i = exp(X_i \beta)
\end{align}
</math>
: <math>\alpha</math> is the dispersion parameter and it's the same for all the genes, following the common practice in RNA-seq analysis
* '''The shrinkage prior is added on <math>\alpha</math>''', it assumes that <math>\alpha</math> is following a hyper-prior distribution like Gamma distribution
: <math>
\begin{align}
\alpha \sim \Gamma(a_0, b_0)
\end{align}
</math>
: This prior allows the shrinkage of <math>\alpha</math> estimates from the data towards a common value across all the genes, which can help to reduce the variance of the estimated log-fold changes.
* The goal is to find the values of mu and alpha that maximize the log-likelihood, this is done by using maximum likelihood estimation (MLE) or Bayesian approach where the prior are considered and integrated in the calculation and the result is the posterior probability.
<li>Dispersion parameter.
* In the context of the negative binomial model used in DESeq2, the dispersion parameter, alpha, is a measure of the degree of overdispersion in the data. In other words, it represents the variability of the data around the mean. A value of alpha greater than 1 indicates that the data is more dispersed (more variable) than would be expected if the data were following a Poisson distribution, which is a common distribution used to model count data. The Poisson distribution has a single parameter, the mean, which represents both the location and the scale of the distribution. In contrast, the negative binomial distribution has two parameters, the mean and the dispersion, which allows for more flexibility in fitting the data.
* The shrinkage method in DESeq2 involves shrinking the estimated values of the dispersion parameter towards a common value across all the genes in the dataset, which can help to reduce the '''variance''' of the '''estimated log-fold changes'''.


== CRAN/Bioconductor packages ==
<li>What is the formula of the fold change estimator given by DESeq2?
=== [https://cran.r-project.org/web/packages/ssizeRNA/index.html ssizeRNA] ===
* The fold change estimator given by the DESeq2 package is calculated as the ratio of the estimated mean expression levels in two conditions, with the log2 of this ratio being the log2 fold change. The mean expression levels are calculated using a negative binomial model, which accounts for both the mean and the overdispersion of the data.
Sample Size Calculation for RNA-Seq Experimental Design
* The estimated mean expression level for a gene i in condition j is given by:
: <math>
\begin{align}
\log(\mu_{i,j}) = \beta_j + X_i \gamma
\end{align}
</math>
: where <math>\beta_j</math> is the overall mean for condition <math>j</math>, <math>X_i</math> is the design matrix for gene <math>i</math> and <math>\gamma_i</math> is the gene-specific effect.
* The log2 fold change is calculated as:
: <math>
\begin{align}
\log2(\mu_{i,j} / \mu_{i,k})
\end{align}
</math>
: where j and k are the two conditions being compared.
* So, you can see that the fold change estimator depends on the design matrix <math>X</math> and the parameters of the model, <math>\beta</math> and <math>\gamma</math>. The DESeq2 implementation also includes an estimation of the variance-covariance matrix of the parameters to compute the standard deviation (uncertainty) of these parameters, and therefore the standard deviation on the fold-change estimator. This can help to estimate the significance of the fold change between conditions.
* Hypothesis testing H0: log(FC)=0 using Wald test


=== [http://master.bioconductor.org/packages/devel/bioc/html/RnaSeqSampleSize.html RnaSeqSampleSize] ===
<li>What is the variance of the estimated log-fold changes before and after applying DESeq2 method?
[https://cqs.mc.vanderbilt.edu/shiny/RnaSeqSampleSize/ Shiny] app
* In RNA-seq data analysis, the log-fold change is a measure of the relative difference in expression between two conditions. The log-fold change is calculated as the log2 of the ratio of the mean expression in one condition to the mean expression in another condition.
* Without using any methods like DESeq2, the variance of the estimated log-fold changes can be high, particularly for genes with low expression levels, which can lead to unreliable results. This high variance is due to the over-dispersion present in RNA-seq data, which results in a large variability in the estimated expression levels even for genes with similar means.
* When using the DESeq2 package, the shrinkage method is applied on dispersion parameter alpha, which helps to reduce the variance of the estimated log-fold changes. By applying a prior on alpha and by shrinking the estimates of alpha towards a common value across all the genes, the method reduces the variability of the estimates. This results in more stable and reliable estimates of the log-fold changes, which can improve the accuracy and robustness of the results of the differential expression analysis.
* Additionally, the DESeq2 package also accounts for differences in sequencing depth across samples, which can also help to reduce the variability of the estimated log-fold changes.


=== [https://cran.r-project.org/web/packages/rbamtools/index.html rbamtools] ===
<li>how DESeq2 package accounts for differences in sequencing depth across samples
Provides an interface to functions of the 'SAMtools' C-Library by Heng Li
* The DESeq2 package accounts for differences in sequencing depth across samples by using the raw count data to estimate the normalized expression levels for each gene in each sample. This normalization process is necessary because sequencing depth can vary widely between samples, leading to differences in the overall number of reads and the apparent expression levels of the genes.
* The package uses a method called regularized-logarithm (rlog) transformation to normalize the data, which is a variance stabilization method that is based on the logarithm of the counts, but also adjusts for the total library size and the mean expression level.
* The method starts by computing a weighted mean of the counts across all samples, which is used as a reference. Next, for each sample, the counts are divided by the library size and then multiplied by the weighted mean of the counts. This scaling step corrects for differences in sequencing depth by making the library sizes comparable between samples.
* Then, the regularized logarithm (rlog) transformation is applied to the scaled counts, which is given by :
: <math>
\begin{align}
vst = \log(counts/sizeFactor + c)
\end{align}
</math>
: where c is a small positive constant added to the counts to stabilize the variance, size_factor is the ratio of library size for each sample over the weighted mean of the library size.
* The rlog transformation can stabilize the variance of the data and make the mean expression levels more comparable between samples. This transformed data can then be used for downstream analysis like calculating the fold changes.
* In addition to rlog transformation the DESeq2 package uses a negative binomial distribution to model the count data, this distribution helps to account for over-dispersion in the data, and shrinkage method on the dispersion parameter is applied as well to improve the stability of results. All of these techniques work together to help correct for sequencing depth differences across samples, which can improve the accuracy of the estimated fold changes and provide more robust results in differential gene expression analysis.


=== [http://cran.r-project.org/web/packages/refGenome/index.html refGenome] ===
<li>[https://www.biostars.org/p/448959/#484944 type='apeglm' shrinkage only for use with 'coef']
The packge contains functionality for import and managing of downloaded genome annotation Data from Ensembl genome browser (European Bioinformatics Institute) and from UCSC genome browser (University of California, Santa Cruz) and annotation routines for genomic positions and splice site positions.
</ul>


=== [http://cran.r-project.org/web/packages/WhopGenome/index.html WhopGenome]  ===
==== Time course experiment ====
Provides very fast access to whole genome, population scale variation data from VCF files and sequence data from FASTA-formatted files. It also reads in alignments from FASTA, Phylip, MAF and other file formats. Provides easy-to-use interfaces to genome annotation from UCSC and Bioconductor and gene ontology data from AmiGO and is capable to read, modify and write PLINK .PED-format pedigree files.
* [http://master.bioconductor.org/packages/release/workflows/vignettes/rnaseqGene/inst/doc/rnaseqGene.html#time-course-experiments RNA-seq workflow: gene-level exploratory analysis and differential expression] using DESeq2
** Genes with small p values from this test are those which at one or more time points after time 0 showed a strain-specific effect. Tested by '''LRT'''.
** '''Wald tests''' for the log2 fold changes at individual time points can be investigated using the test argument


=== [https://cran.r-project.org/web/packages/TCGA2STAT/index.html TCGA2STAT] ===
* [https://www.bioconductor.org/packages/devel/bioc/vignettes/edgeR/inst/doc/edgeRUsersGuide.pdf Time course trend analysis] from the edgeR's vignette. '''glmQLFTest()'''
Simple TCGA Data Access for Integrated Statistical Analysis in R
** Finds genes that respond to the treatment at either 1 hour or 2 hours versus the 0 hour baseline. This is analogous to an '''ANOVA''' F-test for a normal linear model.
** Assuming gene expression changes smoothly over time, we can use a '''polynomial''' or a '''cubic spline curve''' with a certain number of degrees of freedom to model gene expression along time.
** We are looking for genes that change expression level over time. We test for a trend by conducting F-tests for each gene. The ''topTags'' function lists the top set of genes with most significant time effects.
** The total number of genes with significant (5% FDR) changes at different time points can be examined with ''decideTests''.
* [https://support.bioconductor.org/p/9150999/ RNA-seq data collected at different time points]. Identify differentially expressed genes associated with seasonal changes


TCGA2STAT depends on Bioconductor package CNTools which cannot be installed automatically.
==== DESeq2 experimental design and interpretation ====
<syntaxhighlight lang='rsplus'>
[https://rstudio-pubs-static.s3.amazonaws.com/329027_593046fb6d7a427da6b2c538caf601e1.html DESeq2 experimental design and interpretation]
source("https://bioconductor.org/biocLite.R")
biocLite("CNTools")


install.packages("TCGA2STAT")
==== Controlling for batch differences ====
</syntaxhighlight>
The variable we are interested in ("condition") is placed after the batch variable.
<pre>
dds <- DESeqDataSetFromMatrix(countData = cts,
                              colData = coldata,
                              design= ~ batch + condition)
dds <- DESeq(dds)
</pre>
OR
<pre>
dds <- DESeq(dds, test="LRT", reduced=~batch)
res <- results(dds)
</pre>


The getTCGA() function allows to download various kind of data:
==== DESeq2 diagnostic plot, MA plot ====
* '''gene expression''' which includes mRNA-microarray gene expression data (data.type="mRNA_Array") & RNA-Seq gene expression data (data.type="RNASeq")
* [http://www.sthda.com/english/wiki/rna-seq-differential-expression-work-flow-using-deseq2 RNA-Seq differential expression work flow using DESeq2]. MA plot, dispersion plot, histogram of p-values, rlog transoformation.
* '''miRNA expression''' which includes miRNA-array data (data.type="miRNA_Array") & miRNA-Seq data (data.type="miRNASeq")
* [https://bioinformatics-core-shared-training.github.io/Bulk_RNAseq_Course_2021/Markdowns/11_Annotation_and_Visualisation.html RNA-seq Analysis in R Annotation and Visualisation of Differential Expression Results]. MA plot, Volcano plot, venn diagram, heatmap (ComplexHeatmap).
* '''mutation''' data (data.type="Mutation")
* R packages:
* '''methylation expression''' (data.type="Methylation")
** [https://rpkgs.datanovia.com/ggpubr/reference/ggmaplot.html ggpubr::ggmaplot]. It can labels DE genes.
* '''copy number changes''' (data.type="CNA_SNP")
** [https://bioconductor.org/packages/devel/bioc/vignettes/DESeq2/inst/doc/DESeq2.html#ma-plot DESeq2::plotMA]
** limma::plotMA
** edgeR::maPlot
** [https://bioconductor.org/packages/release/bioc/vignettes/Glimma/inst/doc/limma_edger.html Glimma::glimmaMA]
** [https://federicomarini.github.io/ideal/reference/plot_ma.html ideal::plot_ma]
* MA plot
** MA plots help detect systematic biases, especially mean-dependent variability, which is common in RNA-seq.
** Assess Normalization:
*** Before normalization, MA plots often show a curved or spread pattern.
*** After proper normalization (e.g., voom, DESeq2::rlog, or TMM), the cloud of points should be centered at M ≈ 0 across all A levels.
** M can be obtained from '''limma::eBayes(fit)$coefficient[, i]''' or '''limma::topTable(fit)$logFC'''
** M(=log2FC) was used in both MA plots (Y-axis) and volcano plots (X-axis).
** '''A gene with log2FC = 1 might be significant if it’s highly expressed, but not significant if it’s lowly expressed.'''
 
==== vst over rlog transformation ====
* https://twitter.com/mikelove/status/1420671546088173569. See [https://bioconductor.org/packages/release/workflows/vignettes/rnaseqGene/inst/doc/rnaseqGene.html RNA-seq workflow: gene-level exploratory analysis and differential expression]. The transformed data can be used in computing sample distances, PCA, MDS, clustering, ....
* [https://support.bioconductor.org/p/9150245/ normTransform() vs vst()]. [https://rdrr.io/bioc/DESeq2/man/normTransform.html ?normTransform]=log2(x+1). [https://zhuanlan.zhihu.com/p/443966955 DESeq2除了差异分析还有什么要关注的?]
* [https://en.wikipedia.org/wiki/Homoscedasticity Homoscedasticity] = homogeneity of variance
<pre>
Expected counts
    | round()
    v                              /-- vst transformation  ---\
Raw counts --> normalized counts  --                            -- Other analyses such as PCA, Hclust (sample distances).
                                    \-- rlog transformation ---/
</pre>


=== TCGAbiolinks ===
==== Simulate negative binomial distribution data ====
* https://bioconductor.org/packages/3.12/TCGAbiolinks
** data access through GenomicDataCommons
** provides data both from the legacy Firehose pipeline used by the TCGA publications (alignments based on hg18 and hg19 builds2), and the GDC harmonized GRCh38 pipeline
* The [https://rdrr.io/bioc/TCGAbiolinks/man/GDCquery.html help page of GDCquery] does not say it clearly about the option of '''file.type'''.  [https://github.com/BioinformaticsFMRP/TCGAbiolinks/issues/59 How to use TCGAbiolinks to download raw RSEM gene counts for specific type of cancer]. file.type= "results" or file.type= "normalized_results".
<ul>
<ul>
<li>An example from [https://github.com/waldronlab/PublicDataResources Public Data Resources in Bioconductor] workshop 2020. According to ?GDCquery, for the legacy data arguments project, data.category, platform and/or file.extension should be used.
<li>rnegbin() in [https://github.com/cran/ssizeRNA/blob/master/R/sim.counts.R#L114 sim.counts()] from the [https://cran.r-project.org/web/packages/ssizeRNA/index.html ssizeRNA] package
<pre>
<pre>
library(TCGAbiolinks)
rnegbin(10000 * 10, lambda, 1 / disp)  
library(SummarizedExperiment)
# 10000 genes, 20 samples
query <- GDCquery(project = "TCGA-ACC",
# lambda: mean counts from control group, a matrix.
                          data.category = "Gene expression",
# disp: dispersion parameter, a matrix.
                          data.type = "Gene expression quantification",
</pre>
                          platform = "Illumina HiSeq",  
</li>
                          file.type  = "normalized_results",
</ul>
                          experimental.strategy = "RNA-Seq",
 
                          legacy = TRUE)
==== Reducing false positives in differential analyses of large RNA sequencing data sets ====
* [https://www.rna-seqblog.com/reducing-false-positives-in-differential-analyses-of-large-rna-sequencing-data-sets/ Reducing false positives in differential analyses of large RNA sequencing data sets]
* [https://towardsdatascience.com/deseq2-and-edger-should-no-longer-be-the-default-choice-for-large-sample-differential-gene-8fdf008deae9 DESeq2 and edgeR should no longer be the default choices for large-sample differential gene expression analysis]
 
=== edgeR vs DESeq2 vs limma-voom ===
<ul>
<li>edgeR. [https://www.rdocumentation.org/packages/edgeR/versions/3.14.0/topics/calcNormFactors ?calcNormFactors]
<syntaxhighlight lang='r'>
library(edgeR)
 
# create DGEList object from count data
counts <- matrix(c(20,30,25,50,45,55,15,20,10,5,10,8,100,120,110,80,90,95), nrow=3, ncol=6, byrow=TRUE)
rownames(counts) <- c("G1", "G2", "G3")
colnames(counts) <- c("A1", "A2", "A3", "B1", "B2", "B3")
counts
#    A1  A2  A3 B1 B2 B3
# G1  20  30  25 50 45 55
# G2  15  20  10  5 10  8
# G3 100 120 110 80 90 95
d <- DGEList(counts)
 
# perform normalization and differential expression analysis
d <- calcNormFactors(d)
design <- model.matrix(~0+factor(c(rep("A",3), rep("B",3))))
d <- estimateDisp(d, design)
fit <- glmQLFit(d, design)
res <- glmQLFTest(fit, contrast=c(-1, 1))


gdcdir <- file.path("Waldron_PublicData", "GDCdata")
# summarize the results and identify significant genes
GDCdownload(query, method = "api", files.per.chunk = 10,
summary(res)
            directory = gdcdir) # 79 files
res2 <- topTags(res); res2
ACCse <- GDCprepare(query, directory = gdcdir)
# Coefficient:  -1*factor(c(rep("A", 3), rep("B", 3)))A 1*factor(c(rep("A", 3), rep("B", 3)))B
ACCse
#        logFC  logCPM          F      PValue          FDR
class(ACCse)
# G1  1.1683093 17.98614 146.579840 4.380158e-08 1.314048e-07
dim(assay(ACCse)) # 19947 x 79
# G2 -0.7865080 16.41917  3.056504 1.059256e-01 1.588884e-01
assay(ACCse)[1:3, 1:2] # symbol id
# G3 -0.1437956 19.34279  40.852893 2.256279e-01 2.256279e-01
length(unique(rownames(assay(ACCse))))  # 19672
de_genes <- rownames(res2)[which(res2$FDR < 0.05 & abs(res2$log2FoldChange) > 1)]
rowData(ACCse)[1:2, ]
</syntaxhighlight>
# DataFrame with 2 rows and 3 columns
</li>
#         gene_id entrezgene ensembl_gene_id
<li>DESeq2. The count data above will result in an error. The error can occur when there is very little variability in the count data, which can happen if the biological samples are very homogeneous or if the sequencing depth is very low. In such cases, it may be difficult to reliably identify differentially expressed genes using DESeq2.
#      <character> <integer>     <character>
<syntaxhighlight lang='r'>
# A1BG        A1BG          1 ENSG00000121410
library(DESeq2)
# A2M          A2M          2 ENSG00000175899
 
</pre>
col_data <- data.frame(condition = factor(rep(c("treated", "untreated"), c(3, 3))))
 
# create a DESeq2 dataset object
dds <- DESeqDataSetFromMatrix(countData = counts, colData = col_data, design = ~ condition)
 
# differential expression analysis
dds <- DESeq(dds)
# estimating size factors
# estimating dispersions
# gene-wise dispersion estimates
# mean-dispersion relationship
# Error in estimateDispersionsFit(object, fitType = fitType, quiet = quiet) :
#  all gene-wise dispersion estimates are within 2 orders of magnitude
#  from the minimum value, and so the standard curve fitting techniques will not work.
#  One can instead use the gene-wise estimates as final estimates:
#  dds <- estimateDispersionsGeneEst(dds)
#  dispersions(dds) <- mcols(dds)$dispGeneEst
#  ...then continue with testing using nbinomWaldTest or nbinomLRT
</syntaxhighlight>
Try another data.
<syntaxhighlight lang='r'>
count_data <- matrix(c(100, 500, 200, 1000, 300,
                      200, 400, 150, 500, 300,
                      300, 300, 100, 1500, 300,
                      400, 200, 50, 2000, 300), nrow = 5, byrow = TRUE)
 
colnames(count_data) <- paste0("sample", 1:4)
rownames(count_data) <- paste0("gene", 1:5)
col_data <- data.frame(condition = factor(rep(c("treated", "untreated"), c(2, 2))))
 
# create a DESeq2 dataset object
dds <- DESeqDataSetFromMatrix(countData = count_data, colData = col_data, design = ~ condition)
# estimating size factors
# estimating dispersions
# gene-wise dispersion estimates
# mean-dispersion relationship
# -- note: fitType='parametric', but the dispersion trend was not well captured by the
#    function: y = a/x + b, and a local regression fit was automatically substituted.
#    specify fitType='local' or 'mean' to avoid this message next time.
# final dispersion estimates
# fitting model and testing
# Warning message:
# In lfproc(x, y, weights = weights, cens = cens, base = base, geth = geth,  :
#   Estimated rdf < 1.0; not estimating variance
 
# differential expression analysis
dds <- DESeq(dds)
 
# extract results
res <- results(dds)
res
# log2 fold change (MLE): condition untreated vs treated
# Wald test p-value: condition untreated vs treated
# DataFrame with 5 rows and 6 columns
#       baseMean log2FoldChange    lfcSE      stat    pvalue      padj
#       <numeric>     <numeric> <numeric> <numeric> <numeric> <numeric>
# gene1  465.558      0.707313  1.243608  0.568758 0.5695201  0.711900
# gene2  309.591      -0.119330  0.885551 -0.134752 0.8928081  0.892808
# gene3  413.959      -0.742921  0.513376 -1.447130 0.1478604  0.369651
# gene4  638.860      -1.372724  1.428977 -0.960634 0.3367360  0.561227
# gene5  721.470      2.928705  1.536174  1.906493 0.0565863  0.282931
 
# extract DE genes with adjusted p-value < 0.05 and |log2 fold change| > 1
DESeq2_DE_genes <- subset(res, padj < 0.05 & abs(log2FoldChange) > 1)
 
# print the number of DE genes identified by DESeq2
cat("DESeq2 identified", nrow(DESeq2_DE_genes), "DE genes.\n")
</syntaxhighlight>
</li>
</li>
<li>HTSeq counts data example
 
{{Pre}}
<li>limma-voom. voom is a function in the limma package that modifies RNA-Seq data for use with limma. [https://ucdavis-bioinformatics-training.github.io/2018-June-RNA-Seq-Workshop/thursday/DE.html Differential Expression with Limma-Voom]. [https://www.rdocumentation.org/packages/limma/versions/3.28.14/topics/voom ?voom].
query2 <- GDCquery(project = "TCGA-ACC",
* Converts raw counts to log2-counts per million (log2-CPM) values
                  data.category = "Transcriptome Profiling",
* The voom() function requires a '''design matrix''' for several important reasons
                  data.type = "Gene Expression Quantification",
** Estimating '''mean-variance relationship''': voom uses the design matrix to fit a linear model and calculate residuals, which are then used to estimate the mean-variance trend in the data
                  workflow.type="HTSeq - Counts")  
** Calculating weights: The fitted values from the linear model are used to interpolate variances for each observation based on the mean-variance trend. These variances are then used to compute precision weights for each observation
gdcdir2 <- file.path("Waldron_PublicData", "GDCdata2")
** Adjusting for heteroscedasticity: The weights calculated using the design matrix help adjust for the heteroscedasticity typically present in RNA-seq count data
GDCdownload(query2, method = "api", files.per.chunk = 10,
** Accounting for experimental design: The design matrix allows voom to consider the experimental structure, including factors like treatment groups or batch effects, when estimating the mean-variance relationship
            directory = gdcdir2) # 79 files
** We get '''smoothed, stabilized variances''', rather than heteroscedastic (noisy at low counts) variance of genes.
ACCse2 <- GDCprepare(query2, directory = gdcdir2)
<syntaxhighlight lang='r'>
ACCse2
library(limma)
dim(assay(ACCse2)) # 56457 x 79
library(edgeR)
assay(ACCse2)[1:3, 1:2] # ensembl id
 
rowData(ACCse2)[1:2, ]
# Create a design matrix with the sample groups
DataFrame with 2 rows and 3 columns
design_matrix <- model.matrix(~ condition, data = col_data)
                ensembl_gene_id external_gene_name original_ensembl_gene_id
 
                    <character>       <character>              <character>
# Transform RNA-Seq Data Ready for Linear Modelling; see the limma vignette
ENSG00000000003 ENSG00000000003             TSPAN6      ENSG00000000003.13
 
ENSG00000000005 ENSG00000000005               TNMD        ENSG00000000005.5
# Method 1: voom transformation is applied to the scale normalized and filtered DGEList object
</pre>
# The filterByExpr() function from the edgeR package is an automated method for
# filtering low-count genes in RNA-seq data analysis.
dge <- DGEList(counts)
keep <- filterByExpr(dge, design)
dge <- dge[keep,,keep.lib.sizes=FALSE]
dge <- calcNormFactors(dge)
v <- voom(dge, design_matrix, plot=TRUE)
 
# Method 2: convert the read counts to log2-cpm
# filter out low-expressed genes
if (FALSE) {
  keep <- rowSums(counts) >= 10
  counts <- counts[keep,]
}
# give a matrix of counts directly to voom without TMM normalization
v <- voom(count, design_matrix)
 
# linear model fitting
fit <- lmFit(v, design_matrix)
 
# Calculate the empirical Bayes statistics
fit <- eBayes(fit)
 
top.table <- topTable(fit, sort.by = "P", n = Inf)
top.table
#            logFC  AveExpr          t    P.Value adj.P.Val        B
# gene3 -2.3242262 15.67787 -1.8229203 0.08330054 0.3153894 -4.249298
# gene5  2.0865122 16.34012  1.5960616 0.12615577 0.3153894 -4.376405
# gene1  0.5610761 16.69722  0.5079444 0.61704872 0.7551329 -4.834183
# gene2  0.2477959 18.69843  0.3829295 0.70581164 0.7551329 -5.150958
# gene4  0.2869870 17.11809 0.3161922 0.75513288 0.7551329 -4.963932
 
# Perform hypothesis testing to identify DE genes
results <- decideTests(fit)
 
summary(results)
#       (Intercept) conditionuntreated
# Down             0                  0
# NotSig          0                  5
# Up               5                 0
 
# Extract the DE genes
de_genes <- rownames(count_data)[which(results$all != 0)]
</syntaxhighlight>
</li>
</li>
<li>Clinical data
</ul>
<pre>
 
acc_clin <- GDCquery_clinic(project = "TCGA-ACC", type = "Clinical")
==== DESeq2 vs edgeR ====
dim(acc_clin)
D vs E?
# [1] 92 71
 
</pre>
* One major difference is in the method used to estimate the '''dispersion''' parameter. DESeq2 uses a '''local regression''' method, whereas edgeR uses a '''Cox-Reid profile-adjusted likelihood''' method. The local regression method estimates the dispersion parameter for each gene independently, whereas the profile-adjusted likelihood method estimates a common dispersion parameter for all genes, with gene-specific scaling factors that depend on the mean expression levels.
</li>
* Another difference is in the approach to '''normalization'''. DESeq2 uses a '''variance-stabilizing transformation''' to account for differences in library size and composition, whereas edgeR uses a '''trimmed mean of M-values (TMM)''' normalization method, which adjusts for library size differences by scaling the counts of each sample to a common effective library size.
<li>[https://www.rdocumentation.org/packages/TCGAbiolinks/versions/1.2.5/topics/TCGAanalyze_DEA TCGAanalyze_DEA()]. Differentially Expression Analysis (DEA) Using '''edgeR''' Package.
* DESeq2 also uses a different '''statistical model''' for differential expression analysis. DESeq2 models the count data as a negative binomial distribution, but includes additional terms to account for batch effects and other sources of variation. It uses a '''shrinkage estimator''' to improve the estimation of fold changes and reduce false positives. EdgeR, on the other hand, uses a similar negative binomial model but applies an '''empirical Bayes''' method to estimate gene-specific dispersions and to borrow information across genes to improve the power of detection and reduce false positives.
<pre>
 
dataNorm <- TCGAbiolinks::TCGAanalyze_Normalization(dataBRCA, geneInfo)
When should I choose DESeq2 and when should I choose edgeR?
dataFilt <- TCGAanalyze_Filtering(tabDF = dataBRCA, method = "quantile", qnt.cut =  0.25)
* The choice between DESeq2 and edgeR for differential gene expression analysis depends on several factors, including the experimental design, sample size, and the nature of the biological question being investigated. Here are some general guidelines to help you choose between these two algorithms:
samplesNT <- TCGAquery_SampleTypes(colnames(dataFilt), typesample = c("NT"))
* Choose DESeq2 when:
samplesTP <- TCGAquery_SampleTypes(colnames(dataFilt), typesample = c("TP"))
** The experimental design includes multiple batches or covariates that may affect the gene expression levels
dataDEGs <- TCGAanalyze_DEA(dataFilt[,samplesNT],
** The '''sample size is small''', typically fewer than 12 samples per group
                      dataFilt[,samplesTP],"Normal", "Tumor")
** The gene expression levels are highly variable across replicates, and the goal is to identify differentially expressed genes with a low false discovery rate (FDR)
# 2nd example
** The focus is on the fold change rather than the statistical significance of differential expression
dataDEGs <- TCGAanalyze_DEA(mat1 = dataFiltLGG, mat2 = dataFiltGBM,
* Choose edgeR when:
                          Cond1type = "LGG", Cond2type = "GBM",
** The experimental design includes several factors, such as treatment, time, and biological replicate, and the goal is to identify the main effects and interaction effects of these factors on gene expression
                          fdr.cut = 0.01,  logFC.cut = 1,
** The sample size is moderate to large, typically more than 12 samples per group
                          method = "glmLRT")
** The gene expression levels are less variable across replicates, and the goal is to achieve high statistical power to detect differentially expressed genes
</pre>
** The focus is on both the fold change and the statistical significance of differential expression, and the researcher is interested in performing downstream analyses such as gene set enrichment analysis or pathway analysis.
</li>
 
<li>Enrichment analysis
Huge different results between edgeR and DESeq2.
<pre>
* '''Different statistical models''': DESeq2 and edgeR use different statistical approaches to model gene expression data. DESeq2 employs a '''Wald test''' by default, while edgeR uses a '''quasi-likelihood F-test'''. These distinct methods can lead to divergent p-value calculations. See [https://www.biostars.org/p/9552174/ Hugely different results between edgeR and DESeq2].
ansEA <– TCGAanalyze_EAcomplete(TFname="DEA genes LGG Vs GBM",  
* '''Outlier handling''': DESeq2 automatically performs outlier removal by default, whereas edgeR does not. This difference in outlier treatment could significantly affect p-values for genes with extreme values. See [https://www.biostars.org/p/9552174/ Hugely different results between edgeR and DESeq2].
                                RegulonList = rownames(dataDEGs))
* '''Dispersion estimation''': The two methods use different approaches for estimating dispersion, which is crucial for modeling biological variability. DESeq2's approach might be more sensitive to certain patterns of variability for this particular gene. See [https://mikelove.wordpress.com/2016/09/28/deseq2-or-edger/ DESeq2 or edgeR].
* '''Normalization differences''': Although both methods use similar normalization techniques, subtle differences in implementation could lead to discrepancies in results for some genes. See [https://www.reddit.com/r/bioinformatics/comments/12uslzm/deseq2_edger_challenges/ Deseq2 / EdgeR challenges].
* '''Low count handling''': DESeq2 and edgeR handle genes with low counts differently. If the gene in question has low expression, this could contribute to the observed difference in p-values. See [https://mikelove.wordpress.com/2016/09/28/deseq2-or-edger/ DESeq2 or edgeR].
 
{| class="wikitable"
|+ Comparison of Methods: calcNormFactors vs DESeq2::counts(normalize=TRUE)
|-
! Feature !! calcNormFactors (edgeR) !! DESeq2::counts(normalize=TRUE)
|-
| Normalization Method || TMM/Trimmed Mean of M-values || Median of Ratios (specific implementation of Relative Log Expression/RLE) as factor size (scaling factor)
|-
| Adjusts for Composition Bias? || Yes || Yes
|-
| Output || Scaling factors for normalization (used indirectly) || Normalized counts (explicit output)
|-
| Main Usage || Pipeline integration (CPM, voom) || Direct analysis or visualization
|-
| Implicit Normalization || Yes || Yes
|-
| DE method || 1. Estimates gene-wise dispersions using empirical Bayes methods, <BR/>2. Fits a negative binomial model to the count data, <BR/>3. Performs hypothesis testing using either: Exact test [https://www.rdocumentation.org/packages/edgeR/versions/3.14.0/topics/exactTest exactTest()] or LRT [https://www.rdocumentation.org/packages/edgeR/versions/3.14.0/topics/glmFit glmLRT()]. || 1. Estimates gene-wise dispersions and shrinks these estimates, <BR/>2. Fits a negative binomial model to the count data. <BR/>3. Performs hypothesis testing using the Wald test [https://www.rdocumentation.org/packages/DESeq2/versions/1.12.3/topics/DESeq DESeq()]
|}
 
=== DESeq2 in Python ===
[https://github.com/owkin/PyDESeq2 PyDESeq2], [https://twitter.com/mikelove/status/1651542670785781763 nice work]
 
=== Generalized Linear Models and Plots with edgeR ===
[https://morphoscape.wordpress.com/2020/09/26/generalized-linear-models-and-plots-with-edger-advanced-differential-expression-analysis/ Generalized Linear Models and Plots with edgeR – Advanced Differential Expression Analysis]


TCGAvisualize_EAbarplot(tf = rownames(ansEA$ResBP),
=== [http://www.bioconductor.org/packages/devel/bioc/html/EBSeq.html EBSeq] ===
                        GOBPTab = ansEA$ResBP, GOCCTab = ansEA$ResCC,
An R package for gene and isoform differential expression analysis of RNA-seq data
                        GOMFTab = ansEA$ResMF, PathTab = ansEA$ResPat,
 
                        nRGTab = rownames(dataDEGs),
http://www.rna-seqblog.com/analysis-of-ebv-transcription-using-high-throughput-rna-sequencing/
                        nBar = 20)
 
=== [http://www.bioconductor.org/packages/release/bioc/html/prebs.html prebs] ===
Probe region expression estimation for RNA-seq data for improved microarray comparability
 
=== [http://www.bioconductor.org/packages/release/bioc/html/DEXSeq.html DEXSeq] ===
Inference of differential exon usage in RNA-Seq
 
=== [http://www-personal.umich.edu/~jianghui/rseqnp/ rSeqNP] ===
A non-parametric approach for detecting differential expression and splicing from RNA-Seq data
 
=== [https://peerj.com/articles/3890/ voomDDA]: discovery of diagnostic biomarkers and classification of RNA-seq data ===
http://www.biosoft.hacettepe.edu.tr/voomDDA/
 
== Pathway analysis ==
 
=== About the KEGG pathways ===
* [https://www.gsea-msigdb.org/gsea/msigdb/collections.jsp#C2 MSigDB] database or msigdbr package - seems to be old. It only has 186 KEGG pathways for human.
* [https://www.bioconductor.org/packages/release/data/experiment/html/msigdb.html msigdb] from Bioconductor
<ul>
<li>[http://www.bioconductor.org/packages/release/bioc/html/KEGGREST.html KEGGREST] package directly pull the data from kegg.jp. I can get 337 KEGG pathways for human ('hsa')
<pre>
BiocManager::install("KEGGREST")
library(KEGGREST)
res <- keggList("pathway", "hsa")
length(res) # 337
</pre>
</pre>
</li>
<li>[https://docs.gdc.cancer.gov/Data/Bioinformatics_Pipelines/Expression_mRNA_Pipeline/ mRNA Analysis Pipeline] from GDC documentation.
</li>
</li>
</ul>
</ul>
* Papers
** [https://academic.oup.com/nar/article/44/8/e71/2465925 TCGAbiolinks: an R/Bioconductor package for integrative analysis of TCGA data]
** [https://f1000research.com/articles/5-1542 TCGA Workflow: Analyze cancer genomics and epigenomics data using Bioconductor packages]
** [https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1006701 New functionalities in the TCGAbiolinks package for the study and integration of cancer data from GDC and GTEx]
<ul>
<li>[https://bioconductor.org/packages/release/bioc/html/SummarizedExperiment.html RangedSummarizedExperiment] class
<ul>
<li>assay(() </li>
<li>colData() </li>
<li>rowData() </li>
<li>assayNames() </li>
<li>metadata() </li>
<pre>
> dim(colData(ACCse))
[1] 79 72
> dim(rowData(ACCse))
[1] 19947    3
> dim(assay(ACCse))
[1] 19947    79
> assayNames(ACCse)
[1] "normalized_count"
> assayNames(ACCse2)
[1] "HTSeq - Counts"
> metadata(ACCse)
$data_release
[1] "Data Release 25.0 - July 22, 2020"
</pre>
</ul>


=== curatedTCGAData ===
=== GSOAP ===
* [https://www.bioconductor.org/packages/release/data/experiment/html/curatedTCGAData.html Curated Data From The Cancer Genome Atlas (TCGA) as MultiAssayExperiment Objects]
[https://academic.oup.com/bioinformatics/article/36/9/2923/5715574 GSOAP: a tool for visualization of gene set over-representation analysis]
** data access through ExperimentHub
 
** provides data from the legacy Firehose pipeline
=== clusterProfiler ===
* [https://waldronlab.io/MultiAssayWorkshop/ Multi-omic Integration and Analysis of cBioPortal and TCGA data with MultiAssayExperiment] from [https://bioc2020.bioconductor.org/workshops.html Bioc2020]
* [https://bioconductor.org/packages/release/bioc/html/clusterProfiler.html clusterProfiler]
<ul>
* [http://yulab-smu.top/clusterProfiler-book/chapter6.html#kegg-gene-set-enrichment-analysis Chapter 6 KEGG analysis]
<li>[https://waldronlab.io/PublicDataResources/ Public data resources and Bioconductor] from [https://bioc2020.bioconductor.org/workshops.html Bioc2020]
 
<pre>
=== [http://bioconductor.org/packages/release/bioc/html/fgsea.html fgsea:] Fast Gene Set Enrichment Analysis ===
library(curatedTCGAData)
* [https://bioinformatics.stackexchange.com/a/166 Are fgsea and Broad Institute GSEA equivalent?]. Note that enrichment score are the same though the way of calculating p-values can be different.
library(MultiAssayExperiment)
* [https://stephenturner.github.io/deseq-to-fgsea/ DESeq results to pathways in 60 Seconds with the fgsea package]
curatedTCGAData(diseaseCode = "*", assays = "*")
* [https://mgrcbioinfo.github.io/my_GSEA_plot/ GSEA plot for multiple comparisons]
curatedTCGAData(diseaseCode = "ACC")
* [https://davetang.org/muse/2018/01/10/using-fast-preranked-gene-set-enrichment-analysis-fgsea-package/ Using the fast preranked gene set enrichment analysis (fgsea) package] 2018


ACCmae <- curatedTCGAData("ACC", c("RPPAArray", "RNASeq2GeneNorm"),
=== [http://bioconductor.org/packages/release/bioc/html/GSEABenchmarkeR.html GSEABenchmarkeR]: Reproducible GSEA Benchmarking ===
                          dry.run=FALSE)
[https://www.biorxiv.org/content/10.1101/674267v1 Towards a gold standard for benchmarking gene set enrichment analysis]
ACCmae
dim(colData(ACCmae)) # 79 (samples) x 822 (features)


head(metadata(colData(ACCmae))[["subtypes"]])
=== hypeR ===
</pre>
* [https://academic.oup.com/bioinformatics/article/36/4/1307/5566242 hypeR: an R package for geneset enrichment workflows]
</li>
* [https://montilab.github.io/hypeR-workshop/ Efficient, Scalable, and Reproducible Enrichment Workflows] from [https://bioc2020.bioconductor.org/workshops.html Bioc2020]
</ul>
* Caveats for working with TCGA data
** Not all TCGA samples are cancer, there are a mix of samples in each of the 33 cancer types.
** Use sampleTables on the MultiAssayExperiment object along with data(sampleTypes, package = "TCGAutils") to see what samples are present in the data.  
** There may be tumors that were used to create multiple contributions leading to technical replicates. These should be resolved using the appropriate helper functions such as mergeReplicates.
** Primary tumors should be selected using '''TCGAutils::TCGAsampleSelect''' and used as input to the subsetting mechanisms.


=== [https://bioconductor.org/packages/release/bioc/html/caOmicsV.html caOmicsV] ===
=== [https://bioconductor.org/packages/release/bioc/html/rgsepd.html GSEPD] ===
http://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-0989-6 Data from TCGA ws used
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2697-5 GSEPD: a Bioconductor package for RNA-seq gene set enrichment and projection display]


Visualize multi-dimentional cancer genomics data including of patient information, gene expressions, DNA methylations, DNA copy number variations, and SNP/mutations in matrix layout or network layout.
=== SeqGSEA ===
http://www.bioconductor.org/packages/release/bioc/html/SeqGSEA.html


=== [https://cran.r-project.org/web/packages/Map2NCBI/index.html Map2NCBI] ===
=== BAGSE ===
The GetGeneList() function is useful to download Genomic Features (including gene features/symbols) from NCBI (ftp://ftp.ncbi.nih.gov/genomes/MapView/).
[https://academic.oup.com/bioinformatics/article/36/6/1689/5614816 BAGSE: a Bayesian hierarchical model approach for gene set enrichment analysis] 2020


<syntaxhighlight lang='rsplus'>
=== GeneSetCluster ===
> library(Map2NCBI)
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-03784-z GeneSetCluster: a tool for summarizing and integrating gene-set analysis results]
> GeneList = GetGeneList("Homo sapiens", build="ANNOTATION_RELEASE.107", savefiles=TRUE, destfile=path.expand("~/"))
  # choose [2], [n], and [1] to filter the build and feature information.
  # The destination folder will contain seq_gene.txt, seq_gene.md.gz and GeneList.txt files.
> str(GeneList)
'data.frame': 52157 obs. of  15 variables:
$ tax_id      : chr  "9606" "9606" "9606" "9606" ...
$ chromosome  : chr  "1" "1" "1" "1" ...
$ chr_start    : num  11874 14362 17369 30366 34611 ...
$ chr_stop    : num  14409 29370 17436 30503 36081 ...
$ chr_orient  : chr  "+" "-" "-" "+" ...
$ contig      : chr  "NT_077402.3" "NT_077402.3" "NT_077402.3" "NT_077402.3" ...
$ ctg_start    : num  1874 4362 7369 20366 24611 ...
$ ctg_stop    : num  4409 19370 7436 20503 26081 ...
$ ctg_orient  : chr  "+" "-" "-" "+" ...
$ feature_name : chr  "DDX11L1" "WASH7P" "MIR6859-1" "MIR1302-2" ...
$ feature_id  : chr  "GeneID:100287102" "GeneID:653635" "GeneID:102466751" "GeneID:100302278" ...
$ feature_type : chr  "GENE" "GENE" "GENE" "GENE" ...
$ group_label  : chr  "GRCh38.p2-Primary" "GRCh38.p2-Primary" "GRCh38.p2-Primary" "GRCh38.p2-Primary" ...
$ transcript  : chr  "Assembly" "Assembly" "Assembly" "Assembly" ...
$ evidence_code: chr  "-" "-" "-" "-" ...
> GeneList$feature_name[grep("^NAP", GeneList$feature_name)]
</syntaxhighlight>


=== TCseq: Time course sequencing data analysis ===
== Pipeline ==
http://bioconductor.org/packages/devel/bioc/html/TCseq.html


=== UCSCXenaTools ===
=== SPEAQeasy ===
https://github.com/ropensci/UCSCXenaTools
[https://rna-seqblog.com/speaqeasy-a-scalable-pipeline-for-expression-analysis-and-quantification-for-r-bioconductor-powered-rna-seq-analyses/ SPEAQeasy] – a scalable pipeline for expression analysis and quantification for R/Bioconductor-powered RNA-seq analyses


=== RTCGA ===
=== Nextflow ===
https://www.bioconductor.org/packages/release/bioc/html/RTCGA.html
* [https://www.nextflow.io/ Nextflow]: Data-driven computational pipelines, [https://www.nextflow.io/blog.html Blog].
* [https://www.nextflow.io/example4.html RNA-Seq pipeline]


== GEO ==
=== GeneTEFlow ===
See the internal link at [[R#GEO_.28Gene_Expression_Omnibus.29|R-GEO]].
[https://rna-seqblog.com/geneteflow-a-nextflow-based-pipeline-for-analysing-gene-and-transposable-elements-expression-from-rna-seq-data/ GeneTEFlow] – A Nextflow-based pipeline for analysing gene and transposable elements expression from RNA-Seq data


[https://www.biorxiv.org/content/early/2018/05/19/326223 GREIN: An interactive web platform for re-analyzing GEO RNA-seq data]
=== pipeComp ===
[https://github.com/plger/pipeComp/ pipeComp], a general framework for the evaluation of computational pipelines, reveals performant single-cell RNA-seq preprocessing tools


=== GEO2RNAseq ===
=== [https://github.com/PF2-pasteur-fr/SARTools SARTools] ===
[https://www.biorxiv.org/content/10.1101/771063v1.full GEO2RNAseq: An easy-to-use R pipeline for complete pre-processing of RNA-seq data]
http://www.rna-seqblog.com/sartools-a-deseq2-and-edger-based-r-pipeline-for-comprehensive-differential-analysis-of-rna-seq-data/


== proteomics ==
=== SEQprocess ===
[https://www.bioconductor.org/help/course-materials/2016/BioC2016/ConcurrentWorkshops4/Gatto/Bioc2016.html R/Bioconductor tools for mass spectrometry-based proteomics]
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2676-x SEQprocess]: a modularized and customizable pipeline framework for NGS processing in R package


= Journals =
=== GEMmaker ===
== Biometrical Journal ==
[https://github.com/SystemsGenetics/GEMmaker GEMmaker], [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-022-04629-7 Paper]
* https://onlinelibrary.wiley.com/journal/15214036
* [https://onlinelibrary.wiley.com/page/journal/15214036/homepage/forauthors.html Author's Guideline]
* [https://onlinelibrary.wiley.com/results/global-subject-codes/st30?target=topic-title-results&startPage=&PubType=journal Biostatistics (topic) journals] from Wiley


== [https://academic.oup.com/biostatistics/issue Biostatistics] ==
== pasilla and pasillaBamSubset Data ==
pasilla - Data package with per-exon and per-gene read counts of RNA-seq samples of Pasilla knock-down by Brooks et al., Genome Research 2011.


== [https://academic.oup.com/bioinformatics Bioinformatics] ==
pasillaBamSubset - Subset of BAM files untreated1.bam (single-end reads) and untreated3.bam (paired-end reads) from "Pasilla" experiment (Pasilla knock-down by Brooks et al., Genome Research 2011).
[https://academic.oup.com/bioinformatics/search-results?f_TocHeadingTitle=GENOME%20ANALYSIS Genome Analysis] section


== [https://bmcbioinformatics.biomedcentral.com/ BMC Bioinformatics] ==
== [http://www.bioconductor.org/packages/release/bioc/html/BitSeq.html BitSeq] ==
Transcript expression inference and differential expression analysis for RNA-seq data. The homepage of [http://www.hiit.fi/u/ahonkela/ Antti Honkela].


== [https://www.biorxiv.org/ BioRxiv] ==
== ReportingTools ==
The [http://www.bioconductor.org/packages/release/bioc/html/ReportingTools.html ReportingTools] software package enables users to easily display reports of analysis results generated from sources such as microarray and sequencing data.


== PLOS ==
Figures can be included in a cell in output table. See [http://www.bioconductor.org/packages/release/bioc/vignettes/ReportingTools/inst/doc/microarrayAnalysis.pdf#page=3 Using ReportingTools in an Analysis of Microarray Data].


= Software =
It is suggested by e.g. EnrichmentBrowser.
== BRB-SeqTools ==
https://brb.nci.nih.gov/seqtools/


== [http://mev.tm4.org/#/welcome WebMeV] ==
== [http://cran.r-project.org/web/packages/sequences/index.html sequences] ==
* [http://cancerres.aacrjournals.org/content/77/21/e11 WebMeV: A Cloud Platform for Analyzing and Visualizing Cancer Genomic Data]
More or less an educational package. It has 2 c and c++ source code. It is used in Advanced R programming and package development.


== GeneSpring ==
== [http://www.bioconductor.org/packages/release/bioc/html/QuasR.html QuasR] ==
RNA-Seq
[http://bioinformatics.oxfordjournals.org/content/early/2014/12/09/bioinformatics.btu781.short?rss=1&ssource=mfr Bioinformatics] paper


== CCBR Exome Pipeliner ==
== CRAN/Bioconductor packages ==
https://ccbr.github.io/Pipeliner/
=== [https://cran.r-project.org/web/packages/ssizeRNA/index.html ssizeRNA] ===
* Sample Size Calculation for RNA-Seq Experimental Design
* [https://youtu.be/SapuPiaiNjs?t=1327 B4B: Module 2 - RNAseq power calculation]


== Tibanna ==
=== RNASeqPower ===
[https://data.4dnucleome.org/ Tibanna] helps you run your genomic pipelines on Amazon cloud (AWS). It is used by the 4DN DCIC (4D Nucleome Data Coordination and Integration Center) to process data. Tibanna supports CWL/WDL (w/ docker), Snakemake (w/ conda) and custom Docker/shell command.
[https://bioconductor.org/packages/release/bioc/html/RNASeqPower.html RNASeqPower] Sample size for RNAseq studies


== [https://github.com/PMBio/MOFA MOFA]: Multi-Omics Factor Analysis ==
=== [http://master.bioconductor.org/packages/devel/bioc/html/RnaSeqSampleSize.html RnaSeqSampleSize] ===
[https://cqs.mc.vanderbilt.edu/shiny/RnaSeqSampleSize/ Shiny] app


== Benchmarking ==
=== [https://cran.r-project.org/web/packages/rbamtools/index.html rbamtools] ===
[https://genomebiology.biomedcentral.com/articles/10.1186/s13059-019-1738-8 Essential guidelines for computational method benchmarking]
Provides an interface to functions of the 'SAMtools' C-Library by Heng Li


= Simulation =
=== [http://cran.r-project.org/web/packages/refGenome/index.html refGenome] ===
* [https://www.biostars.org/p/128762/ NGS reads simulation]
The packge contains functionality for import and managing of downloaded genome annotation Data from Ensembl genome browser (European Bioinformatics Institute) and from UCSC genome browser (University of California, Santa Cruz) and annotation routines for genomic positions and splice site positions.


== Simulate RNA-Seq ==
=== [http://cran.r-project.org/web/packages/WhopGenome/index.html WhopGenome]  ===
* http://en.wikipedia.org/wiki/List_of_RNA-Seq_bioinformatics_tools#RNA-Seq_simulators
Provides very fast access to whole genome, population scale variation data from VCF files and sequence data from FASTA-formatted files. It also reads in alignments from FASTA, Phylip, MAF and other file formats. Provides easy-to-use interfaces to genome annotation from UCSC and Bioconductor and gene ontology data from AmiGO and is capable to read, modify and write PLINK .PED-format pedigree files.
* https://popmodels.cancercontrol.cancer.gov/gsr/packages/


=== [http://maq.sourceforge.net Maq] ===
=== [https://cran.r-project.org/web/packages/TCGA2STAT/index.html TCGA2STAT] ===
Used by [https://academic.oup.com/bioinformatics/article/25/9/1105/203994/TopHat-discovering-splice-junctions-with-RNA-Seq TopHat: discovering splice junctions with RNA-Seq]
Simple TCGA Data Access for Integrated Statistical Analysis in R


=== BEERS/Grant G.R. 2011 ===
TCGA2STAT depends on Bioconductor package CNTools which cannot be installed automatically.  
http://bioinformatics.oxfordjournals.org/content/27/18/2518.long#sec-2. The simulation method is called [http://cbil.upenn.edu/BEERS/ BEERS] and it was used in the [https://academic.oup.com/bioinformatics/article/29/1/15/272537/STAR-ultrafast-universal-RNA-seq-aligner STAR] software paper.
<syntaxhighlight lang='rsplus'>
source("https://bioconductor.org/biocLite.R")
biocLite("CNTools")


For the command line options of <'''reads_simulator.pl'''> and more details about the config files that are needed/prepared by BEERS, see [https://gist.github.com/arraytools/dd62bcca60cc36a1d1769d1a4a7d226b this gist].
install.packages("TCGA2STAT")
</syntaxhighlight>


This can generate paired end data but they are in one FASTA file.
The getTCGA() function allows to download various kind of data:
* '''gene expression''' which includes mRNA-microarray gene expression data (data.type="mRNA_Array") & RNA-Seq gene expression data (data.type="RNASeq")
* '''miRNA expression''' which includes miRNA-array data (data.type="miRNA_Array") & miRNA-Seq data (data.type="miRNASeq")
* '''mutation''' data (data.type="Mutation")
* '''methylation expression''' (data.type="Methylation")
* '''copy number changes''' (data.type="CNA_SNP")


<syntaxhighlight lang='bash'>
=== TCGAbiolinks ===
$ sudo apt-get install cpanminus
* https://www.bioconductor.org/packages/release/bioc/html/TCGAbiolinks.html. Many vignettes.
$ sudo cpanm Math::Random
* https://bioconductor.org/packages/3.12/TCGAbiolinks
$ wget http://cbil.upenn.edu/BEERS/beers.tar
** data access through GenomicDataCommons
$
** provides data both from the legacy Firehose pipeline used by the TCGA publications (alignments based on hg18 and hg19 builds2), and the GDC harmonized GRCh38 pipeline
$ tar -xvf beers.tar      # two perl files <make_config_files_for_subset_of_gene_ids.pl> and <reads_simulator.pl>
* The [https://rdrr.io/bioc/TCGAbiolinks/man/GDCquery.html help page of GDCquery] does not say it clearly about the option of '''file.type'''. [https://github.com/BioinformaticsFMRP/TCGAbiolinks/issues/59 How to use TCGAbiolinks to download raw RSEM gene counts for specific type of cancer]. file.type= "results" or file.type= "normalized_results".
$
<ul>
$ cd ~/Downloads/
<li>An example from [https://github.com/waldronlab/PublicDataResources Public Data Resources in Bioconductor] workshop 2020. According to ?GDCquery, for the legacy data arguments project, data.category, platform and/or file.extension should be used.
$ mkdir beers_output 
<pre>
$ mkdir beers_simulator_refseq && cd "$_"
library(TCGAbiolinks)
$ wget http://itmat.rum.s3.amazonaws.com/simulator_config_refseq.tar.gz
library(SummarizedExperiment)
$ tar xzvf simulator_config_refseq.tar.gz
query <- GDCquery(project = "TCGA-ACC",
$ ls -lth
                          data.category = "Gene expression",
total 1.4G
                          data.type = "Gene expression quantification",
-rw-r--r-- 1 brb brb  44M Sep 16  2010 simulator_config_featurequantifications_refseq
                          platform = "Illumina HiSeq",
-rw-r--r-- 1 brb brb 7.7M Sep 15  2010 simulator_config_geneinfo_refseq
                          file.type = "normalized_results",
-rw-r--r-- 1 brb brb 106M Sep 15  2010 simulator_config_geneseq_refseq
                          experimental.strategy = "RNA-Seq",
-rw-r--r-- 1 brb brb 1.3G Sep 15 2010 simulator_config_intronseq_refseq
                          legacy = TRUE)
$ cd ~/Downloads/
$ perl reads_simulator.pl 100 testbeers \
  -configstem refseq \
  -customcfgdir ~/Downloads/beers_simulator_refseq \
  -outdir ~/Downloads/beers_output


$ ls -lh beers_output
gdcdir <- file.path("Waldron_PublicData", "GDCdata")
total 3.9M
GDCdownload(query, method = "api", files.per.chunk = 10,
-rw-r--r-- 1 brb brb 1.8K Mar 16 15:25 simulated_reads2genes_testbeers.txt
            directory = gdcdir)  # 79 files
-rw-r--r-- 1 brb brb 1.2M Mar 16 15:25 simulated_reads_indels_testbeers.txt
ACCse <- GDCprepare(query, directory = gdcdir)
-rw-r--r-- 1 brb brb 1.6K Mar 16 15:25 simulated_reads_junctions-crossed_testbeers.txt
ACCse
-rw-r--r-- 1 brb brb 2.7M Mar 16 15:25 simulated_reads_substitutions_testbeers.txt
class(ACCse)
-rw-r--r-- 1 brb brb 6.3K Mar 16 15:25 simulated_reads_testbeers.bed
dim(assay(ACCse))  # 19947 x 79
-rw-r--r-- 1 brb brb  31K Mar 16 15:25 simulated_reads_testbeers.cig
assay(ACCse)[1:3, 1:2] # symbol id
-rw-r--r-- 1 brb brb 22K Mar 16 15:25 simulated_reads_testbeers.fa
length(unique(rownames(assay(ACCse))))  #  19672
-rw-r--r-- 1 brb brb  584 Mar 16 15:25 simulated_reads_testbeers.log
rowData(ACCse)[1:2, ]
 
# DataFrame with 2 rows and 3 columns
$ wc -l simulated_reads2genes_testbeers.txt
#          gene_id entrezgene ensembl_gene_id
102 simulated_reads2genes_testbeers.txt
#      <character>  <integer>    <character>
$ head -4 simulated_reads2genes_testbeers.txt
# A1BG        A1BG          1 ENSG00000121410
seq.1 GENE.5600
# A2M          A2M          2 ENSG00000175899
seq.2 GENE.35506
</pre>
seq.3 GENE.506
</li>
seq.4 GENE.34922
<li>HTSeq counts data example. [https://github.com/wwylab/DeMixT/issues/19 DeMixT]. [https://support.bioconductor.org/p/9149780/ Error when running GDC_prepare].
$ tail -4 simulated_reads2genes_testbeers.txt
{{Pre}}
seq.97 GENE.4197
query2 <- GDCquery(project = "TCGA-ACC",
seq.98 GENE.8763
                  data.category = "Transcriptome Profiling",
seq.99 GENE.19573
                  data.type = "Gene Expression Quantification",
seq.100 GENE.18830
                  workflow.type="HTSeq - Counts") # or "STAR - Counts"
$ wc -l simulated_reads_indels_testbeers.txt
gdcdir2 <- file.path("Waldron_PublicData", "GDCdata2")
36131 simulated_reads_indels_testbeers.txt
GDCdownload(query2, method = "api", files.per.chunk = 10,
$ head -2 simulated_reads_indels_testbeers.txt
            directory = gdcdir2)  # 79 files
chr1:6052304-6052531 25 1 G
ACCse2 <- GDCprepare(query2, directory = gdcdir2)
chr2:73899436-73899622 141 3 ATA
ACCse2
$ tail -2 simulated_reads_indels_testbeers.txt
dim(assay(ACCse2))  # 56457 x 79
chr4:68619532-68621804 1298 -2 AA
assay(ACCse2)[1:3, 1:2] # ensembl id
chr21:32554738-32554962 174 1 T
rowData(ACCse2)[1:2, ]
$ wc -l simulated_reads_substitutions_testbeers.txt
DataFrame with 2 rows and 3 columns
71678 simulated_reads_substitutions_testbeers.txt
                ensembl_gene_id external_gene_name original_ensembl_gene_id
$ head -2 simulated_reads_substitutions_testbeers.txt
                    <character>        <character>              <character>
chr22:50902963-50903167 50903077 G->A
ENSG00000000003 ENSG00000000003            TSPAN6      ENSG00000000003.13
chr1:6052304-6052531 6052330 G->C
ENSG00000000005 ENSG00000000005              TNMD        ENSG00000000005.5
$ wc -l simulated_reads_junctions-crossed_testbeers.txt
</pre>
49  simulated_reads_junctions-crossed_testbeers.txt
</li>
$ head -2 simulated_reads_junctions-crossed_testbeers.txt
<li>Clinical data
seq.1a chrX:49084601-49084713
<pre>
seq.1b chrX:49084909-49086682
acc_clin <- GDCquery_clinic(project = "TCGA-ACC", type = "Clinical")
dim(acc_clin)
# [1] 92 71
</pre>
</li>
<li>[https://www.rdocumentation.org/packages/TCGAbiolinks/versions/1.2.5/topics/TCGAanalyze_DEA TCGAanalyze_DEA()]. Differentially Expression Analysis (DEA) Using '''edgeR''' Package.
<pre>
dataNorm <- TCGAbiolinks::TCGAanalyze_Normalization(dataBRCA, geneInfo)
dataFilt <- TCGAanalyze_Filtering(tabDF = dataBRCA, method = "quantile", qnt.cut =  0.25)
samplesNT <- TCGAquery_SampleTypes(colnames(dataFilt), typesample = c("NT"))
samplesTP <- TCGAquery_SampleTypes(colnames(dataFilt), typesample = c("TP"))
dataDEGs <- TCGAanalyze_DEA(dataFilt[,samplesNT],
                      dataFilt[,samplesTP],"Normal", "Tumor")
# 2nd example
dataDEGs <- TCGAanalyze_DEA(mat1 = dataFiltLGG, mat2 = dataFiltGBM,
                          Cond1type = "LGG", Cond2type = "GBM",
                          fdr.cut = 0.01, logFC.cut = 1,
                          method = "glmLRT")
</pre>
</li>
<li>Enrichment analysis
<pre>
ansEA <– TCGAanalyze_EAcomplete(TFname="DEA genes LGG Vs GBM",
                                RegulonList = rownames(dataDEGs))


$ cat beers_output/simulated_reads_testbeers.log
TCGAvisualize_EAbarplot(tf = rownames(ansEA$ResBP),
Simulator run: 'testbeers'
                        GOBPTab = ansEA$ResBP, GOCCTab = ansEA$ResCC,
started: Thu Mar 16 15:25:39 EDT 2017
                        GOMFTab = ansEA$ResMF, PathTab = ansEA$ResPat,
num reads: 100
                        nRGTab = rownames(dataDEGs),
readlength: 100
                        nBar = 20)
substitution frequency: 0.001
</pre>
indel frequency: 0.0005
</li>
base error: 0.005
<li>[https://docs.gdc.cancer.gov/Data/Bioinformatics_Pipelines/Expression_mRNA_Pipeline/ mRNA Analysis Pipeline] from GDC documentation.
low quality tail length: 10
</li>
percent of tails that are low quality: 0
</ul>
quality of low qulaity tails: 0.8
* See the vignette in the [https://bioconductor.org/packages/release/workflows/html/SingscoreAMLMutations.html SingscoreAMLMutations] package.
percent of alt splice forms: 0.2
* Papers
number of alt splice forms per gene: 2
** [https://academic.oup.com/nar/article/44/8/e71/2465925 TCGAbiolinks: an R/Bioconductor package for integrative analysis of TCGA data]
stem: refseq
** [https://f1000research.com/articles/5-1542 TCGA Workflow: Analyze cancer genomics and epigenomics data using Bioconductor packages]
sum of gene counts: 3,886,863,063
** [https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1006701 New functionalities in the TCGAbiolinks package for the study and integration of cancer data from GDC and GTEx]
sum of intron counts = 1,304,815,198
<ul>
sum of intron counts = 2,365,472,596
<li>[https://bioconductor.org/packages/release/bioc/html/SummarizedExperiment.html RangedSummarizedExperiment] class
intron frequency: 0.355507598105262
<ul>
padded intron frequency: 0.52453796437909
<li>assay(() </li>
finished at Thu Mar 16 15:25:58 EDT 2017
<li>colData() </li>
 
<li>rowData() </li>
$ wc -l simulated_reads_testbeers.fa
<li>assayNames() </li>
400 simulated_reads_testbeers.fa
<li>metadata() </li>
$ head simulated_reads_testbeers.fa
<pre>
>seq.1a
> dim(colData(ACCse))
CGAAGAAGGACCCAAAGATGACAAGGCTCACAAAGTACACCCAGGGCAGTTCATACCCCATGGCATCTTGCATCCAGTAGAGCACATCGGTCCAGCCTTC
[1] 79 72
>seq.1b
> dim(rowData(ACCse))
GCTCGAGCTGTTCCTTGGACGAATGCACAAGACGTGCTACTTCCTGGGATCCGACATGGAAGCGGAGGAGGACCCATCGCCCTGTGCATCTTCGGGATCA
[1] 19947    3
>seq.2a
> dim(assay(ACCse))
GCCCCAGCAGAGCCGGGTAAAGATCAGGAGGGTTAGAAAAAATCAGCGCTTCCTCTTCCTCCAAGGCAGCCAGACTCTTTAACAGGTCCGGAGGAAGCAG
[1] 19947    79
>seq.2b
> assayNames(ACCse)
ATGAAGCCTTTTCCCATGGAGCCATATAACCATAATCCCTCAGAAGTCAAGGTCCCAGAATTCTACTGGGATTCTTCCTACAGCATGGCTGATAACAGAT
[1] "normalized_count"
>seq.3a
> assayNames(ACCse2)
CCCCAGAGGAGCGCCACCTGTCCAAGATGCAGCAGAACGGCTACGAAAATCCAACCTACAAGTTCTTTGAGCAGATGCAGAACTAGACCCCCGCCACAGC
[1] "HTSeq - Counts"
> metadata(ACCse)
$data_release
[1] "Data Release 25.0 - July 22, 2020"
</pre>
</ul>
<li>[https://rpubs.com/tiagochst/TCGAbiolinks_to_DESEq2 TCGAbiolinks to DESEq2]. My verified version (R 4.3.2 & Bioc ‘3.17’) available on [https://gist.github.com/arraytools/6e6142f6fabb31e54e188ea1fb0deeee Github].
 
</ul>


# Take a look at the true coordinates
=== curatedTCGAData ===
$ head -4 simulated_reads_testbeers.bed # one-based coords and contains both endpoints of each span
* [https://www.bioconductor.org/packages/release/data/experiment/html/curatedTCGAData.html Curated Data From The Cancer Genome Atlas (TCGA) as MultiAssayExperiment Objects]
chrX 49084529 49084601 +
** data access through ExperimentHub
chrX 49084713 49084739 +
** provides data from the legacy Firehose pipeline
chrX 49084863 49084909 +
* [https://waldronlab.io/MultiAssayWorkshop/ Multi-omic Integration and Analysis of cBioPortal and TCGA data with MultiAssayExperiment] from [https://bioc2020.bioconductor.org/workshops.html Bioc2020]
chrX 49086682 49086734 +
<ul>
$ head -4 simulated_reads_testbeers.cig # has a cigar string representation of the mapping coordinates, and a more human readable representation of the coordinates
<li>[https://waldronlab.io/PublicDataResources/ Public data resources and Bioconductor] from [https://bioc2020.bioconductor.org/workshops.html Bioc2020]
seq.1a chrX 49084529 73M111N27M 49084529-49084601, 49084713-49084739 + CGAAGAAGGACCCAAAGATGACAAGGCTCACAAAGTACACCCAGGGCAGTTCATACCCCATGGCATCTTGCATCCAGTAGAGCACATCGGTCCAGCCTTC
<pre>
seq.1b chrX 49084863 47M1772N53M 49084863-49084909, 49086682-49086734 - GCTCGAGCTGTTCCTTGGACGAATGCACAAGACGTGCTACTTCCTGGGATCCGACATGGAAGCGGAGGAGGACCCATCGCCCTGTGCATCTTCGGGATCA
library(curatedTCGAData)
seq.2a chr1 183516256 100M 183516256-183516355 - GCCCCAGCAGAGCCGGGTAAAGATCAGGAGGGTTAGAAAAAATCAGCGCTTCCTCTTCCTCCAAGGCAGCCAGACTCTTTAACAGGTCCGGAGGAAGCAG
library(MultiAssayExperiment)
seq.2b chr1 183515275 100M 183515275-183515374 + ATGAAGCCTTTTCCCATGGAGCCATATAACCATAATCCCTCAGAAGTCAAGGTCCCAGAATTCTACTGGGATTCTTCCTACAGCATGGCTGATAACAGAT
curatedTCGAData(diseaseCode = "*", assays = "*")
$ wc -l simulated_reads_testbeers.fa
curatedTCGAData(diseaseCode = "ACC")
400 simulated_reads_testbeers.fa
$ wc -l simulated_reads_testbeers.bed
247 simulated_reads_testbeers.bed
$ wc -l simulated_reads_testbeers.cig
200 simulated_reads_testbeers.cig
</syntaxhighlight>


=== [http://sammeth.net/confluence/display/SIM/Home Flux] Sammeth 2010 ===
ACCmae <- curatedTCGAData("ACC", c("RPPAArray", "RNASeq2GeneNorm"),
                          dry.run=FALSE)
ACCmae
dim(colData(ACCmae)) # 79 (samples) x 822 (features)


=== [http://www.ebi.ac.uk/goldman-srv/simNGS/ SimNGS] ===
head(metadata(colData(ACCmae))[["subtypes"]])
 
</pre>
=== [http://cran.r-project.org/web/packages/SimSeq/index.html SimSeq]  ===
</li>
[http://bioinformatics.oxfordjournals.org/content/early/2015/02/26/bioinformatics.btv124.abstract Bioinformatics]
</ul>
* Caveats for working with TCGA data
** Not all TCGA samples are cancer, there are a mix of samples in each of the 33 cancer types.
** Use sampleTables on the MultiAssayExperiment object along with data(sampleTypes, package = "TCGAutils") to see what samples are present in the data.  
** There may be tumors that were used to create multiple contributions leading to technical replicates. These should be resolved using the appropriate helper functions such as mergeReplicates.  
** Primary tumors should be selected using '''TCGAutils::TCGAsampleSelect''' and used as input to the subsetting mechanisms.


A data-based simulation algorithm for rna-seq data. The vector of read counts simulated for a given experimental unit has a joint distribution that closely matches the distribution of a source rna-seq dataset provided by the user.
=== [https://bioconductor.org/packages/release/bioc/html/caOmicsV.html caOmicsV] ===
http://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-0989-6 Data from TCGA ws used


=== [http://cran.r-project.org/web/packages/empiricalFDR.DESeq2/index.html empiricalFDR.DESeq2] ===
Visualize multi-dimentional cancer genomics data including of patient information, gene expressions, DNA methylations, DNA copy number variations, and SNP/mutations in matrix layout or network layout.
http://biorxiv.org/content/early/2014/12/05/012211


The key function is '''simulateCounts''', which takes a fitted DESeq2 data object as an input and returns a simulated data object (DESeq2 class) with the same sample size factors, total counts and dispersions for each gene as in real data, but without the effect of predictor variables.  
=== [https://cran.r-project.org/web/packages/Map2NCBI/index.html Map2NCBI] ===
The GetGeneList() function is useful to download Genomic Features (including gene features/symbols) from NCBI (ftp://ftp.ncbi.nih.gov/genomes/MapView/).


Functions fdrTable, fdrBiCurve and empiricalFDR compare the DESeq2 results obtained for the real and simulated data, compute the empirical false discovery rate (the ratio of the number of differentially expressed genes detected in the simulated data and their number in the real data) and plot the results.
<syntaxhighlight lang='rsplus'>
 
> library(Map2NCBI)
=== [http://www.bioconductor.org/packages/release/bioc/html/polyester.html polyester] ===
> GeneList = GetGeneList("Homo sapiens", build="ANNOTATION_RELEASE.107", savefiles=TRUE, destfile=path.expand("~/"))
http://biorxiv.org/content/early/2014/12/05/012211
  # choose [2], [n], and [1] to filter the build and feature information.
 
  # The destination folder will contain seq_gene.txt, seq_gene.md.gz and GeneList.txt files.
Given a set of annotated transcripts, polyester will simulate the steps of an RNA-seq experiment (fragmentation, reverse-complementing, and sequencing) and produce files containing simulated RNA-seq reads.
> str(GeneList)
 
'data.frame': 52157 obs. of 15 variables:
'''Input''': reference FASTA file (containing names and sequences of transcripts from which reads should be simulated) OR a GTF file denoting transcript structures, along with one FASTA file of the DNA sequence for each chromosome in the GTF file.
$ tax_id      : chr  "9606" "9606" "9606" "9606" ...
$ chromosome  : chr  "1" "1" "1" "1" ...
$ chr_start    : num  11874 14362 17369 30366 34611 ...
$ chr_stop    : num  14409 29370 17436 30503 36081 ...
$ chr_orient  : chr  "+" "-" "-" "+" ...
$ contig      : chr  "NT_077402.3" "NT_077402.3" "NT_077402.3" "NT_077402.3" ...
$ ctg_start    : num  1874 4362 7369 20366 24611 ...
$ ctg_stop    : num  4409 19370 7436 20503 26081 ...
$ ctg_orient  : chr  "+" "-" "-" "+" ...
$ feature_name : chr  "DDX11L1" "WASH7P" "MIR6859-1" "MIR1302-2" ...
$ feature_id  : chr  "GeneID:100287102" "GeneID:653635" "GeneID:102466751" "GeneID:100302278" ...
$ feature_type : chr  "GENE" "GENE" "GENE" "GENE" ...
$ group_label  : chr  "GRCh38.p2-Primary" "GRCh38.p2-Primary" "GRCh38.p2-Primary" "GRCh38.p2-Primary" ...
$ transcript  : chr  "Assembly" "Assembly" "Assembly" "Assembly" ...
$ evidence_code: chr  "-" "-" "-" "-" ...
> GeneList$feature_name[grep("^NAP", GeneList$feature_name)]
</syntaxhighlight>
 
=== TCseq: Time course sequencing data analysis ===
http://bioconductor.org/packages/devel/bioc/html/TCseq.html


'''Output''': FASTA files. Reads in the FASTA file will be labeled with the transcript from which they were simulated.
=== UCSC Xena ===
* [https://xena.ucsc.edu/welcome-to-ucsc-xena/ Welcome to UCSC Xena], [https://github.com/ucscXena Source code]. Note one should not confuse it with [https://bioconductor.org/packages/release/bioc/html/Xeva.html Xeva] for analysis PDX data.
* [https://github.com/ropensci/UCSCXenaTools UCSCXenaTools]
* It was used by this tumor purity paper [https://academic.oup.com/bib/article/22/6/bbab163/6265216#312129108 Prediction of tumor purity from gene expression data using machine learning].
 
=== RTCGA ===
https://www.bioconductor.org/packages/release/bioc/html/RTCGA.html
 
=== genefu ===
[https://bioconductor.org/packages/release/bioc/html/genefu.html Computation of Gene Expression-Based Signatures in Breast Cancer]


Too many dependencies. <strike>Got an error in installation.</strike>. It seems it has not considered splice junctions.
== GEO ==
See the internal link at [[R#GEO_.28Gene_Expression_Omnibus.29|R-GEO]].


=== seqgendiff ===
[https://www.biorxiv.org/content/early/2018/05/19/326223 GREIN: An interactive web platform for re-analyzing GEO RNA-seq data]
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-3450-9 Data-based RNA-seq simulations by binomial thinning]


=== [http://deweylab.github.io/RSEM/ RSEM] ===
=== GEO2RNAseq ===
* [https://www.cbioportal.org/ Cbioportal] -> [https://www.cbioportal.org/study/summary?id=brca_tcga_pan_can_atlas_2018 Breast Invasive Carcinoma (TCGA, PanCancer Atlas)] -> Explore selected study -> Original data -> [https://gdc.cancer.gov/about-data/publications/pancanatlas PanCanAtlas Publications] -> RNA (Final) - EBPlusPlusAdjustPANCAN_IlluminaHiSeq_RNASeqV2.geneExp.tsv
[https://www.biorxiv.org/content/10.1101/771063v1.full GEO2RNAseq: An easy-to-use R pipeline for complete pre-processing of RNA-seq data]
* [https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-017-4002-1 Evaluation and comparison of computational tools for RNA-seq isoform quantification] 2017
 
<ul>
== Network-based ==
<li>RSEM gene level result file (see [[#tximport|here for an example]]) contains 5 essential columns (and the element saved by '''tximport'''() function) excluding transcript_id
[https://www.nature.com/articles/s41598-022-19019-5 Network-based integration of multi-omics data for clinical outcome prediction in neuroblastoma] 2022
<ul>
 
<li>Length (not kept). This is different across samples. </li>
== Proteomics ==
<li>[https://groups.google.com/g/rsem-users/c/IaZmviqghJc Effective length] &rarr; length. This is different across samples. This is shorter than Length. </li>
* [https://www.bioconductor.org/packages/release/bioc/html/MatrixQCvis.html MatrixQCvis: Shiny-based interactive data-quality exploration for omics data]
<li>[http://deweylab.biostat.wisc.edu/rsem/rsem-calculate-expression.html Expected count] &rarr; count. This is the sum of the posterior probability of each read comes from this transcript over all reads. </li>
* [https://www.bioconductor.org/help/course-materials/2016/BioC2016/ConcurrentWorkshops4/Gatto/Bioc2016.html R/Bioconductor tools for mass spectrometry-based proteomics]
<li>TPM &rarr; abundance. Supposing the whole transcriptome contains exactly 1 million transcripts </li>
 
<li>FPKM (not kept?). FPKM_i = 10^3 / l_bar * TPM_i for gene i. So for each sample FPKM is a scaling of TPM. </li>
=== OlinkAnalyze ===
</ul>
* https://cran.r-project.org/web/packages/OlinkAnalyze/index.html
* [https://github.com/arnav-mehta/covid19-proteomics/blob/main/20201023_COVID%20pos%20vs%20neg.R 20201023_COVID pos vs neg.R]
 
=== OlinkRPackage ===
* [https://github.com/Olink-Proteomics/OlinkRPackage OlinkRPackage], [https://cran.r-project.org/web/packages/OlinkAnalyze/index.html CRAN]
* [https://github.com/arnav-mehta/covid19-proteomics Plasma proteomics reveals tissue-specific cell death and mediators of cell-cell interactions in severe COVID-19 patients] 2021
* [https://www.olink.com/faq/what-is-npx/ What is NPX?] NPX, Normalized Protein eXpression, is Olink’s arbitrary unit which is in Log2 scale.
* [https://www.sciencedirect.com/science/article/pii/S2666379121001154#appsec2 Longitudinal proteomic analysis of severe COVID-19 reveals survival-associated signatures, tissue-specific cell death, and cell-cell interactions] Filbin 2021. Olink data is available in [https://data.mendeley.com/datasets/nf853r8xsj/1 here].
 
== Mass spectrometry (MS)-based proteomics ==
* This is NOT RPPA (reverse phase protein arrays)
* Phosphoprotein 磷蛋白 -level
* MS-based proteomics has several advantages. It can analyze all the proteins in a system and is unbiased and hypothesis-free 1. MS methods are also ideally suited to discover and quantify post-translational modifications (PTMs) on proteins. MS-based targeted proteomic methods have increased specificity and multiplexing capabilities compared to classical immunological methods.
* [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6731080/ Integration and Analysis of CPTAC Proteomics Data in the Context of Cancer Genomics in the cBioPortal] 2019
* https://proteomics.cancer.gov/data-portal
* [https://docs.cbioportal.org/user-guide/faq/#how-can-i-query-phosphoprotein-levels-in-the-portal How can I query phosphoprotein levels in the portal?]
* R/Bioconductor
** [https://bioconductor.org/packages/release/bioc/html/MSnbase.html MSnbase] from Bioconductor
** https://github.com/lgatto/RforProteomics, [https://lgatto.github.io/bioc-ms-prot/lab.html Bioconductor tools for mass spectrometry and proteomics]
** [https://support.bioconductor.org/p/134743/ Tutorial:Mass Spectrometry Data Analysis with the Spectra Package]
** [https://www.physalia-courses.org/courses-workshops/course58/ R/BIOCONDUCTOR FOR MASS SPECTROMETRY AND PROTEOMICS]
* An example to download data from cbioportal.org
** Go to https://www.cbioportal.org/datasets and search "CPTAC" through the search box or the find function in the browser. It returns 8 hits.
** For example [https://www.cbioportal.org/study/summary?id=coad_cptac_2019 Colon Cancer (CPTAC-2 Prospective, Cell 2019)] contains several molecule profiles to download including samples Phosphoprotein site level expression.
** Click the download button to download the data. "coad_cptac_2019.tar.gz". For this case, "wc -l" shows 31263 rows for phosphoprotein quantification data and 8067 rows for protein quantification data.  
<pre>
<pre>
R> dfpkm[1:5, 1:3] / txi.rsem$abundance[1:5, 1:3]
$ head -5 data_phosphoprotein_quantification.txt' | cut -f 1-5
          144126_210-T_JKQFX5 144126_210-T_JKQFX6 144126_210-T_JKQFX8
ENTITY_STABLE_ID GENE_SYMBOL PHOSPHOSITE 01CO005 01CO006
5S_rRNA            0.7563603            1.118008          0.8485292
AAAS_pS495 AAAS pS495 NA -0.365
5_8S_rRNA                NaN                NaN                NaN
AAAS_pS525 AAAS pS525 NA NA
6M1-18                    NaN                NaN                NaN
AAAS_pS541 AAAS pS541 -0.24 NA
7M1-2                    NaN                NaN                NaN
AAED1_pS12 AAED1 pS12 -0.46 -0.424
7SK                0.7563751            1.118029          0.8485281
 
# R
> summary(x[, 4], na.rm = T)
  Min. 1st Qu. Median    Mean 3rd Qu.    Max.    NA's
-5.776  -1.095  -0.608  -0.690  -0.213  2.383  20378
> summary(as.vector(as.matrix(x[, 4:5])), na.rm = T)
  Min. 1st Qu.  Median    Mean 3rd Qu.    Max.    NA's
  -5.78  -0.81  -0.36  -0.43    0.00    3.13  36304
</pre>
</pre>
</ul>
[[File:Cbioportal cptac.png|350px]]
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-12-323 RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome]. Abundance estimates are given in terms of two measures. For PDX data, the output file (XXX_RNASeq.RSEM.genes.results) contains 6 columns: ID, length, effective Length, effective Count, TPM, FPKM.
 
** Expected counts: The is an estimate of the number of fragments that are derived from a given isoform or gene. This count is generally a non-integer value and is the expectation of the number of alignable and unfiltered fragments that are derived from a isoform or gene given the ML abundances. These (possibly rounded) counts may be used by a differential expression method such as edgeR or DESeq.
== Metabolomics Analysis ==
** TPM: This is the estimated fraction of transcripts made up by a given isoform or gene. The transcript fraction measure is preferred over the popular RPKM/FPKM measures because it is independent of the mean expressed transcript length and is thus more comparable across samples and species.
* [https://www.sciencedirect.com/science/article/pii/S0166526X18300655#s0010 Chapter Fourteen - An Overview of Metabolomics Data Analysis: Current Tools and Future Perspectives] 2018
* [https://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-0940-1 A benchmark for RNA-seq quantification pipelines]. They compare the STAR, TopHat2, and Bowtie2 '''mapping methods''' and the Cufflinks, eXpress , Flux Capacitor, kallisto, RSEM, Sailfish, and Salmon '''quantification methods'''.
* [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9032224/ Guide to Metabolomics Analysis: A Bioinformatics Workflow] 2022
* [https://www.nature.com/articles/s41598-024-59400-0 Integrative analysis of metabolomics and transcriptomics to uncover biomarkers in sepsis] 2024
* [https://www.sciencedirect.com/science/article/abs/pii/S0141813023054624 A comprehensive review of genomics, transcriptomics, proteomics, and metabolomic insights into the differentiation of Pseudomonas aeruginosa from the planktonic to biofilm state: A multi-omics approach] 2024
* R
** [https://metid.tidymass.org/ metid], [https://www.tidymass.org/metid/articles/multiple_databases.html Identify peak tables with multiple databases], [https://metid.tidymass.org/articles/public_databases Database provided for metid],https://hmdb.ca/downloads HMDB database
** [https://bioconductor.org/packages/release/bioc/html/MetID.html MetID]
** [https://rformassspectrometry.github.io/metaRbolomics-book/0207-R_packages_for_metabolomics-Network_analysis_and_biochemical_pathways.html The MetaRbolomics book]
** [https://academic.oup.com/bioinformaticsadvances/article/2/1/vbac067/6702008 metabolomicsR: a streamlined workflow to analyze metabolomic data in R] 2022.
*** [https://github.com/xia-lab/MetaboAnalystR MetaboAnalystR 4.0: a unified LC-MS workflow for global metabolomics]
*** [https://www.metaboanalyst.ca/docs/RTutorial.xhtml MetaboAnalyst6.0 - from raw spectra to biomarkers, patterns, functions and systems biology]
*** [https://www.metaboanalyst.ca/Secure/utils/NameMapView.xhtml Compound Name/ID Standardization]
** [https://cran.r-project.org/web/packages/omu/index.html omu] : A Metabolomics Analysis Tool for Intuitive Figures and Convenient Metadata Collection
** FELLA
*** [https://www.nature.com/articles/s41540-023-00274-9 High-throughput metabolomics for the design and validation of a diauxic shift model] 2023
*** [https://pubs.rsc.org/en/content/articlehtml/2023/fo/d3fo00997a Metabolic regulation and antihyperglycemic properties of diet-derived PGG through transcriptomic and metabolomic profiling] 2023
*** [https://support.bioconductor.org/p/9140352/ Multiple testing correction for p.scores in FELLA]. Can those p-scores be used as p-values? Yes.
*** [https://support.bioconductor.org/p/119264/ How to obtain the KEGG IDs that mapped to a pathway]
*** [https://github.com/b2slab/FELLA/issues/24 How to disable module, enzyme, and gene names in the network?]
*** [https://support.bioconductor.org/p/116881/ consulting about the FELLA package]
*** Make sure to use '''internalDir = TRUE''' option in '''buildDataFromGraph()''' so the database can be shown in the database dropdown menu when we use '''launchApp()''',
*** https://github.com/b2slab/FELLA/blob/master/R/plotGraph.R


== Simulate DNA-Seq ==
* [https://www.metabolomicsworkbench.org/databases/refmet/index.php RefMet: A Reference list of Metabolite names]
* Software list - https://popmodels.cancercontrol.cancer.gov/gsr/packages/
* [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5224698/ A comparison of tools for the simulation of genomic next-generation sequencing data] Merly Escalona 2016


=== wgsim ===
=== Enzyme ===
https://github.com/lh3/wgsim
* [https://www.khanacademy.org/science/biology/gene-expression-central-dogma/central-dogma-transcription/a/one-gene-one-enzyme-hypothesis One gene, one enzyme]. ''The one gene, one enzyme hypothesis is the idea that each gene encodes a single enzyme. Today, we know that this idea is generally (but not exactly) correct.''
<pre>
library(KEGGREST)


* Used by [https://www.biorxiv.org/content/biorxiv/early/2017/12/20/237107.full.pdf#page=3 Cleaning clinical genomic data: Simple identification and removal of recurrently miscalled variants in single genomes] bioRxiv 2017
# Step 1: Retrieve KO entries associated with the enzyme
* [https://gatkforums.broadinstitute.org/gatk/discussion/7859/how-to-simulate-reads-using-a-reference-genome-alt-contig (How to) Simulate reads using a reference genome ALT contig]
enzyme_id <- "ec:2.7.1.1"
* [http://research.cs.wisc.edu/wham/comparison-using-wgsim/ Comparing WHAM with BWA using wgsim
ko_entries <- keggLink("ko", enzyme_id)
* http://biobits.org/samtools_primer.html


=== dwgssim ===
# Step 2: Retrieve genes associated with the KO entries
* [https://github.com/nh13/dwgsim Whole Genome Simulator for Next-Generation Sequencing]
ko_ids <- sub("ko:", "", ko_entries)  # Extract KO IDs
* Example: [https://www.bioinformatics.recipes/recipe/view/recipe-variants-bcftools/#info How to generate variant calls with bcftools]
gene_links <- lapply(ko_ids, function(ko) keggLink("genes", paste0("ko:", ko)))


=== NEAT ===
# Combine results into a data frame
* https://github.com/zstephens/neat-genreads
genes_df <- do.call(rbind, lapply(names(gene_links), function(ko) {
* [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5125660/ Simulating next-generation sequencing datasets from empirical mutation and sequencing models] Zachary Stephens, 2016
  data.frame(KO = ko, Gene = gene_links[[ko]], stringsAsFactors = FALSE)
* If I set 10 as the coverage rate and read length 101, the generated fq file is about 34GB (3.3GB * 10) for each one of the pairs.
}))


=== DNA aligner accuracy: BWA, Bowtie, Soap and SubRead tested with simulated reads ===
# View the first few rows of the genes data frame
http://genomespot.blogspot.com/2014/11/dna-aligner-accuracy-bwa-bowtie-soap.html
head(genes_df)
</pre>
* '''Enzymes''' are the proteins that are encoded by genes.
* Gene → Transcription → mRNA → Translation → Enzyme.
** A '''gene''' is a segment of DNA that contains the instructions for making a protein. It's like a blueprint or a recipe for creating a specific protein.
** '''Transcription''': When a gene is "turned on" or expressed, the DNA sequence is transcribed into a complementary RNA molecule called messenger RNA (mRNA). This process is like copying the recipe from the DNA blueprint.
** '''mRNA''': The mRNA molecule carries the genetic information from the DNA to the ribosome, which is the site of protein synthesis.
** '''Translation''': The mRNA sequence is translated into a sequence of amino acids, which are the building blocks of proteins. This process is like following the recipe to assemble the ingredients into a final product.
** '''Enzyme''': The resulting '''protein''', in this case, is an enzyme. Enzymes are biological molecules that catalyze specific chemical reactions, allowing them to speed up or facilitate various biological processes. An enzyme is a type of protein, but not all proteins are enzymes.


<syntaxhighlight lang='bash'>
== Protein-protein interaction/PPI ==
$ head simDNA_100bp_16del.fasta
<ul>
>Pt-0-100
<li>https://en.wikipedia.org/wiki/Protein%E2%80%93protein_interaction
TGGCGAACGCGGGAATTGACCGCGATGGTGATTCACATCACTCCTAATCCACTTGCTAATCGCCCTACGCTACTATCATTCTTT
<li>[https://www.r-bloggers.com/2012/06/obtaining-a-protein-protein-interaction-network-for-a-gene-list-in-r/ Obtaining a protein-protein interaction network for a gene list in R] and other related posts.
>Pt-10-110
<li>[https://a-little-book-of-r-for-bioinformatics.readthedocs.io/en/latest/src/chapter11.html Protein-Protein Interaction Graphs]
GCGGGATTGAACCCGATTGAATTCCAATCACTGCTTAATCCACTTGCTACATCGCCCTACGTACTATCTATTTTTTTGTATTTC
<li>[https://downloads.thebiogrid.org/BioGRID/ BioGRID], [https://onlinelibrary.wiley.com/doi/10.1002/pro.3978 The BioGRID database: A comprehensive biomedical resource of curated protein, genetic, and chemical interactions]
>Pt-20-120
<pre>
GAACCCGCGATGAATTCAATCCACTGCTACCATTGGCTACATCCGCCCCTACGCTACTCTTCTTTTTTGTATGTCTAAAAAAAA
$ wc -l BIOGRID-ALL-4.4.214.tab.txt                                                                              12:07:59
>Pt-30-130
2454000 BIOGRID-ALL-4.4.214.tab.txt
TGGTGAATCACAATCACTGCCTAACCATTGGCTACATCCGCCCCTACGCTACACTATTTTTTGTATTGCTAAAAAAAAAAATAA
</pre>
>Pt-40-140
<pre>
ACAACACTGCCTAATCCACTTGGCTACTCCGCCCCTAGCTACTATCTTTTTTTGTATTTCTAAAAAAAAAAAATCAATTTCAAT
R> x <- read.delim("BIOGRID-ALL-4.4.214.tab.txt", skip=35, nrows=10)
</syntaxhighlight>
R> dim(x)
[1] 10 11
R> x[1:2, ]
  INTERACTOR_A INTERACTOR_B OFFICIAL_SYMBOL_A OFFICIAL_SYMBOL_B
1      ETG6416      ETG2318            MAP2K4              FLNC
2    ETG84665        ETG88              MYPN            ACTN2
                                                      ALIASES_FOR_A
1 JNKK|JNKK1|MAPKK4|MEK4|MKK4|PRKMK4|SAPKK-1|SAPKK1|SEK1|SERK1|SKK1
2                                            CMD1DD|CMH22|MYOP|RCM4
                            ALIASES_FOR_B EXPERIMENTAL_SYSTEM          SOURCE
1 ABP-280|ABP280A|ABPA|ABPL|FLN2|MFM5|MPD4          Two-hybrid  Marti A (1997)
2                                  CMD1AA          Two-hybrid  Bang ML (2001)
  PUBMED_ID ORGANISM_A_ID ORGANISM_B_ID
1  9006895          9606          9606
2  11309420          9606          9606
</pre>
<li>[https://academic.oup.com/bioinformatics/article/38/24/5390/6769888 Defining the extent of gene function using ROC curvature] 2022
<li>https://string-db.org/, [https://bioconductor.org/packages/release/bioc/html/STRINGdb.html STRINGdb] R package. When using the web service, remember to
* minimum required interaction score: 0.90 instead of the default 0.40
* hide disconnected nodes in the network
<li>Cytoscrape
* [https://zhuanlan.zhihu.com/p/111001011 Cytoscape之stringAPP蛋白互作分析详解]
* [https://zhuanlan.zhihu.com/p/455182867 STRING网站+Cytoscape软件制作精美蛋白互作网络图(PPI)]
</ul>


=== Simulate Whole genome ===
== Drug-Drug Interactions ==
* [https://github.com/nh13/dwgsim DWGSIM] mentioned by [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3785481/ Variant Callers for Next-Generation Sequencing Data: A Comparison Study]. For its usage, see http://davetang.org/wiki/tiki-index.php?page=DWGSIM
[https://appsilon.com/drug-drug-interactions-r-shiny/ Understanding Drug-Drug Interactions Using R Shiny]


=== Simulate whole exome ===
= Journals =
* https://www.biostars.org/p/66714/ (no final answer)
* Impact factor: [https://www.bioxbio.com/subject/medicine Top Journals in medicine]
* [https://academic.oup.com/bioinformatics/article/29/8/1076/225073 Wessim: a whole-exome sequencing simulator based on in silico exome capture] Sangwoo Kim 2013 & [http://sak042.github.io/Wessim/ software]
* [https://www.scijournal.org/ SCI Journal]


=== SCSIM ===
== Biometrical Journal ==
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-03550-1 SCSIM: Jointly simulating correlated single-cell and bulk next-generation DNA sequencing data]
* https://onlinelibrary.wiley.com/journal/15214036
* [https://onlinelibrary.wiley.com/page/journal/15214036/homepage/forauthors.html Author's Guideline]
* [https://onlinelibrary.wiley.com/results/global-subject-codes/st30?target=topic-title-results&startPage=&PubType=journal Biostatistics (topic) journals] from Wiley


== Variant simulator ==
== [https://academic.oup.com/biostatistics/issue Biostatistics] ==
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2611-1 sim1000G: a user-friendly genetic variant simulator in R for unrelated individuals and family-based designs]
 
== [https://academic.oup.com/bioinformatics Bioinformatics] ==
[https://academic.oup.com/bioinformatics/search-results?f_TocHeadingTitle=GENOME%20ANALYSIS Genome Analysis] section
 
== [https://bmcbioinformatics.biomedcentral.com/ BMC Bioinformatics] ==
 
== [https://www.biorxiv.org/ BioRxiv] ==


== Mutation-Simulator ==
== PLOS ==
[https://github.com/mkpython3/Mutation-Simulator Mutation-Simulator]


== SigProfilerSimulator ==
== MDPI ==
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-03772-3 Generating realistic null hypothesis of cancer mutational landscapes using SigProfilerSimulator]
https://en.wikipedia.org/wiki/MDPI, [https://twitter.com/MKarhulahti/status/1723296939649683689 All MDPI, Frontiers & Hindawi] journals planned to be erased (level 0) from Finnish academic assessment by end of 2024.


== Convert FASTA to FASTQ ==
= Software =
It is interesting to note that the simulated/generated FASTA files can be used by alignment/mapping tools like BWA just like FASTQ files.
== BRB-SeqTools ==
https://brb.nci.nih.gov/seqtools/


If we want to convert FASTA files to FASTQ files, use https://code.google.com/archive/p/fasta-to-fastq/. The quality score 'I' means 40 (the highest) by Sanger (range [0,40]). See https://en.wikipedia.org/wiki/FASTQ_format. The Wikipedia website also mentions FASTQ read simulation tools and a comparison of these tools.
== [http://mev.tm4.org/#/welcome WebMeV] ==
* [http://cancerres.aacrjournals.org/content/77/21/e11 WebMeV: A Cloud Platform for Analyzing and Visualizing Cancer Genomic Data]


<syntaxhighlight lang='bash'>
== GeneSpring ==
$ cat test.fasta
RNA-Seq
>Pt-0-50
 
TGGCGAACGACGGGAATACCCGGAGGTGAATTCAAATCCACT
== CCBR Exome Pipeliner ==
>Pt-10-60
https://ccbr.github.io/Pipeliner/
GACGGAATTGAACCCGATGGGATACAATCCACTGCCTTATCC
>Pt-20-70
GAACCCGCGATGGTGTCACAATCCACTCTTAACCATTGCTAC
>Pt-30-80
GGTGAATTCACAATCCACTGCCTTACCACTTGGCTACCCCCT
>Pt-40-90
AATCCACTGCCTTATCCACTGGCTACATCCCTACGCTACTAT
$ perl ~/Downloads/fasta_to_fastq.pl test.fasta
@Pt-0-50
TGGCGAACGACGGGAATACCCGGAGGTGAATTCAAATCCACT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@Pt-10-60
GACGGAATTGAACCCGATGGGATACAATCCACTGCCTTATCC
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@Pt-20-70
GAACCCGCGATGGTGTCACAATCCACTCTTAACCATTGCTAC
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@Pt-30-80
GGTGAATTCACAATCCACTGCCTTACCACTTGGCTACCCCCT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@Pt-40-90
AATCCACTGCCTTATCCACTGGCTACATCCCTACGCTACTAT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
</syntaxhighlight>


Alternatively we can use just one line of code by [https://www.reddit.com/r/bioinformatics/comments/32pu00/fasta_to_fastq_converter/ awk]
== Tibanna ==
<syntaxhighlight>
[https://data.4dnucleome.org/ Tibanna] helps you run your genomic pipelines on Amazon cloud (AWS). It is used by the 4DN DCIC (4D Nucleome Data Coordination and Integration Center) to process data. Tibanna supports CWL/WDL (w/ docker), Snakemake (w/ conda) and custom Docker/shell command.
$ awk 'BEGIN {RS = ">" ; FS = "\n"} NR > 1 {print "@"$1"\n"$2"\n+"; for(c=0;c<length($2);c++) printf "H"; printf "\n"}' \
 
  test.fasta > test.fq
== [https://github.com/PMBio/MOFA MOFA]: Multi-Omics Factor Analysis ==
$ cat test.fq
 
@Pt-0-50
== WGCNA ==
TGGCGAACGACGGGAATACCCGGAGGTGAATTCAAATCCACT
* It uses a network method to create '''distance''' matrix for genes. We can further to use Hierarchical clustering to create groups/modules/clusters of genes.
+
* [https://en.wikipedia.org/wiki/Weighted_correlation_network_analysis Weighted gene '''co-expression''' network analysis]
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
* [https://youtu.be/OpWEHazyQLA Webinar #7 – Introduction to Weighted Gene Co-expression Network Analysis] (video)
@Pt-10-60
* [https://www.biostars.org/p/397669/ how is the topological overlap (TOM) algorithm calculated?]
GACGGAATTGAACCCGATGGGATACAATCCACTGCCTTATCC
+
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
@Pt-20-70
GAACCCGCGATGGTGTCACAATCCACTCTTAACCATTGCTAC
+
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
@Pt-30-80
GGTGAATTCACAATCCACTGCCTTACCACTTGGCTACCCCCT
+
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
@Pt-40-90
AATCCACTGCCTTATCCACTGGCTACATCCCTACGCTACTAT
+
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
</syntaxhighlight>
Change the 'H' to the quality score value that you need (Depending what phred score scale you are using).


== Simulate genetic data ==
== Benchmarking ==
[https://onunicornsandgenes.blog/2019/06/16/simulating-genetic-data-with-r-an-example-with-deleterious-variants-and-a-pun/ ‘Simulating genetic data with R: an example with deleterious variants (and a pun)’]
[https://genomebiology.biomedcentral.com/articles/10.1186/s13059-019-1738-8 Essential guidelines for computational method benchmarking]


= PDX/Xenograft =
= Simulation =
* https://en.wikipedia.org/wiki/Patient_derived_xenograft
* [https://www.biostars.org/p/128762/ NGS reads simulation]
* [https://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-15-1172 Are special read alignment strategies necessary and cost-effective when handling sequencing reads from patient-derived tumor xenografts?] by Tso et al, BMC Genomics, 2014.
 
* [http://www.arrayserver.com/wiki/index.php?title=Align_Ion_Torrent_reads Map xenograft reads] by [http://www.omicsoft.com/array-studio/ Array Suite]
== Simulate RNA-Seq ==
* [http://www.pdxfinder.org/ PDXFinder] includes PDMR as one of 6 providers. The website source code https://github.com/PDXFinder/pdxfinder.
* http://en.wikipedia.org/wiki/List_of_RNA-Seq_bioinformatics_tools#RNA-Seq_simulators
** [http://www.pdxfinder.org/data/pdx/IRCC/CRC0120LM#variation A Colorectal Carcinoma example] contains 'genomic data'. Each row represents one seq position. No raw FASTQ files available.
* https://popmodels.cancercontrol.cancer.gov/gsr/packages/
* NCI [https://pdmr.cancer.gov/models/database.htm Patient-Derived Models Repository (PDMR)].
** ftp://dctdftp.nci.nih.gov/pub/pdm/
** The ftp link can be obtained by clicking 'PDMR Models' -> 'PDMR database' -> Click here to access the PDMR Database -> 'Genomic Analysis'.
** There will be three tabs: NCI Cancer Genome Panel (4246 records), Whole Exome Sequence (785 records) and RNASeq (807 records).
** For Whole Exome Sequence, '''VCF''' was provided. For RNASeq, '''TPM''' files per genes or isoforms are available.
** The '''RNASeq Transcriptome Data Analysis Pipeline and Specifications''' and '''Whole Exome Sequencing Data Analysis Pipeline and Specifications''' are available under SOPs. [https://pdmdb.cancer.gov/pls/apex/f?p=101:34:0::NO:34:: RNASeq] TPM data.
* [https://www.rna-seqblog.com/reproducible-bioinformatics-project/ Reproducible Bioinformatics Project]
* [https://academic.oup.com/bioinformatics/article/28/12/i172/269972 Xenome] a tool for classifying reads from xenograft samples, Thomas Conway et al 2012.
** [https://en.wikipedia.org/wiki/K-mer K-mer]
** The program is bundled in '''[https://github.com/data61/gossamer/blob/master/docs/xenome.md Gossamer]''' (Github)
** [https://hpc.nih.gov/apps/gossamer.html Biowulf] It is noted that Gossamer runs in a Singularity container
** Indexing took 13 hours when I set 16 threads and 24GB memory (25.4GB was used). A set of 23 files with prefix 'idx' will be generated.
: <syntaxhighlight lang='bash'>
#!/bin/bash
module load gossamer
xenome index -M 24 -T 16 -P idx \
  -H $HOME/igenomes/Mus_musculus/UCSC/mm9/Sequence/WholeGenomeFasta/genome.fa \
  -G $HOME/igenomes/Homo_sapiens/UCSC/hg19/Sequence/WholeGenomeFasta/genome.fa
</syntaxhighlight>
* [http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0074432 Next-Generation Sequence Analysis of Cancer Xenograft Models] by Fernando J. Rossello et al 2013.
* [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4991491/ Whole transcriptome profiling of patient-derived xenograft models as a tool to identify both tumor and stromal specific biomarkers] Bradford et al 2016
* [https://f1000research.com/articles/5-2741/v1 An open-source application for disambiguating two species in next generation sequencing data from grafted samples] by Ahdesmäki MJ et al 2016. [https://github.com/AstraZeneca-NGS/disambiguate Disambiguation]
* [http://mcr.aacrjournals.org/content/molcanres/15/8/1012.full.pdf Next-Generation Sequencing Analysis and Algorithms for PDX and CDX Models] by Garima Khandelwal et al 2017. [https://github.com/CRUKMI-ComputationalBiology/bamcmp bamcmp] software.
* [https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-017-4414-y Computational approach to discriminate human and mouse sequences in patient-derived tumour xenografts] by Maurizio Callari et al 2018. Both RNA-Seq and DNA-Seq are considered. Software [https://github.com/cclab-brca/ICRG ICRG].
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2353-5 XenofilteR: computational deconvolution of mouse and human reads in tumor xenograft sequence data] Kluin et al 2018. Software in [https://github.com/PeeperLab/XenofilteR github].
* [https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1006596 Whole genomes define concordance of matched primary, xenograft, and organoid models of pancreas cancer] Gendoo et al 2019
* [https://cancerres.aacrjournals.org/content/79/17/4539 Integrative Pharmacogenomics Analysis of Patient-Derived Xenografts] 2019
* [https://pubmed.ncbi.nlm.nih.gov/31262303/ Genomic data analysis workflows for tumors from patient-derived xenografts (PDXs): challenges and guidelines] 2019


== RNA-Seq ==
=== [http://maq.sourceforge.net Maq] ===
* Platform [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GPL16791 GPL16791] Illumina HiSeq 2500
Used by [https://academic.oup.com/bioinformatics/article/25/9/1105/203994/TopHat-discovering-splice-junctions-with-RNA-Seq TopHat: discovering splice junctions with RNA-Seq]
** https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM1702792
 
** https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM1887215
=== BEERS/Grant G.R. 2011 ===
* [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GPL25431 GPL25431] Illumina HiSeq 4000 (Homo sapiens; Mus musculus)
http://bioinformatics.oxfordjournals.org/content/27/18/2518.long#sec-2. The simulation method is called [http://cbil.upenn.edu/BEERS/ BEERS] and it was used in the [https://academic.oup.com/bioinformatics/article/29/1/15/272537/STAR-ultrafast-universal-RNA-seq-aligner STAR] software paper.
** GSE118197
* [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GPL18573 GPL18573] Illumina NextSeq 500
** GSE106336  [https://www.nature.com/articles/s41467-017-01967-6 MYC] regulates ductal-neuroendocrine lineage plasticity in pancreatic ductal adenocarcinoma associated with poor outcome and chemoresistance
* [https://youtu.be/j4qpJ8sVjT0 Mastering RNA-Seq (NGS Data Analysis) - A Critical Approach To Transcriptomic Data Analysis]. This is posted on [https://www.rna-seqblog.com/mastering-rna-seq-data-analysis-a-critical-approach-to-transcriptomic-data-analysis/ rna-seqblog]. See the link [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4991491/ Whole transcriptome profiling of patient-derived xenograft models as a tool to identify both tumor and stromal specific biomarkers].
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-03633-z PDXGEM]: patient-derived tumor xenograft-based gene expression model for predicting clinical response to anticancer therapy in cancer patients


== DNA-Seq ==
For the command line options of <'''reads_simulator.pl'''> and more details about the config files that are needed/prepared by BEERS, see [https://gist.github.com/arraytools/dd62bcca60cc36a1d1769d1a4a7d226b this gist].
* [http://www.sciencedirect.com/science/article/pii/S2211124713004634 Endocrine-Therapy-Resistant ESR1 Variants Revealed by Genomic Characterization of Breast-Cancer-Derived Xenografts]
** [https://www.ncbi.nlm.nih.gov/projects/gap/cgi-bin/molecular.cgi?study_id=phs000611.v1.p1&phv=195714&phd=&pha=&pht=3502&phvf=&phdf=&phaf=&phtf=&dssp=1&consent=&temp=1 dbGaP]
** GaP accession [https://trace.ncbi.nlm.nih.gov/Traces/study/?acc=phs000611 phs000611].
* https://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=xenograft&go=Go
* [https://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?study=ERP021871 ERP021871]


== MAF (TCGA, GDC) ==
This can generate paired end data but they are in one FASTA file.
* See [https://brb.nci.nih.gov/d3oncoprint/D3Oncoprint-UserManual.pdf#page=17 D3Oncoprint] manual. D3oncoprint uses java to create the interface (java -jar D3Oncoprint.jar). The result is shown in a browser. The top part is a heatmap and the bottom part is a table. The heatmap is good only for a small number of variants and there is no way to zoom in if we have a lot of variants (eg 1000). The phenotypes file is optional. The following 3 columns are required and the others are for tooltip and table. The column name from a VCF file input is given below.
** '''Gene column''': GENE
** '''Variant type column''': ExonicFunc.refGene
** '''Aminoacid change column''': AAChange.refGene (this defines the name of '''variant'''. The variant uses the single letter aminoacid codes. This information is only used in HTML table. For example if AAChange.refGene=UGT1A7:NM_019077:exon1:c.T387G:p.N129K, then the variant will be N129K. My observation is the variant name for variant type 'frameshift_deletion' is altered in table; R128fs -> R128Xfs)
* https://www.reddit.com/r/bioinformatics/comments/cmdza5/vcf_and_maf_file_formats/ which links to
** MAF: https://docs.gdc.cancer.gov/Data/File_Formats/MAF_Format/
** VCF: https://gatk.broadinstitute.org/hc/en-us/articles/360035531692?id=11005
* [https://pdmr.cancer.gov/content/docs/MCCRD_SOP0023_v2.0_PDX_consensus_files.pdf The Standing Operating Procedure (SOP) describes procedures for generating consensus/intersect variants calls for reporting in the NCI Patient-Derived Models database]
* Convert vcf to maf. https://hpc.nih.gov/apps/vcf2maf.html
* [https://www.bioconductor.org/packages/release/bioc/vignettes/maftools/inst/doc/maftools.html#10_variant_annotations maftools] : Summarize, Analyze and Visualize MAF Files (oncoplots)
* https://www.bioconductor.org/packages/release/bioc/html/TCGAbiolinks.html
** [https://www.biostars.org/p/295833/ Use TCGAbiolinks package] to download maf file.


= DNA Seq Data =
<syntaxhighlight lang='bash'>
== NIH ==
$ sudo apt-get install cpanminus
* Go to [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=search_obj SRA/Sequence Read Archive]and type the keywords 'Whole Genome Sequencing human'. An example of the procedures to search whole genome sequencing data from human samples:
$ sudo cpanm Math::Random
*# Enter 'Whole Genome Sequencing human' in ncbi/sra search sra objects at http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=search_obj
$ wget http://cbil.upenn.edu/BEERS/beers.tar
*# The webpage will return the result in terms of SRA experiments, SRA studies, Biosamples, GEO datasets. I pick SRA studies from Public Access.
$
*# The result is sorted by the Accession number (does not take the first 3 letters like DRP into account). The Accession number has a format SRPxxxx. So I just go to the Last page (page 98)
$ tar -xvf beers.tar      # two perl files <make_config_files_for_subset_of_gene_ids.pl> and <reads_simulator.pl>
*# I pick the first one Accession:SRP066837 from this page. The page shows the '''Study type''' is whole genome sequence. http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?study=SRP066837
$
*# <span style="color: red">(Important trick)</span> Click the number next to '''Run'''. It will show a summary (SRR #, library name, MBases, age, biomaterial provider, isolate and sex) about all samples. http://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP066837
$ cd ~/Downloads/
*# Download the raw data from any one of them (eg SRR2968056). For whole genome, the '''Strategy''' is ''WGS''. For whole exome, the '''Strategy''' is called ''WXS''.  
$ mkdir beers_output 
* Search the keywords 'nonsynonymous' and 'human' in [http://www.ncbi.nlm.nih.gov/pmc/?term=nonsynonymous+human PMC]
$ mkdir beers_simulator_refseq && cd "$_"
$ wget http://itmat.rum.s3.amazonaws.com/simulator_config_refseq.tar.gz
$ tar xzvf simulator_config_refseq.tar.gz
$ ls -lth
total 1.4G
-rw-r--r-- 1 brb brb  44M Sep 16  2010 simulator_config_featurequantifications_refseq
-rw-r--r-- 1 brb brb 7.7M Sep 15  2010 simulator_config_geneinfo_refseq
-rw-r--r-- 1 brb brb 106M Sep 15  2010 simulator_config_geneseq_refseq
-rw-r--r-- 1 brb brb 1.3G Sep 15  2010 simulator_config_intronseq_refseq
$ cd ~/Downloads/
$ perl reads_simulator.pl 100 testbeers \
  -configstem refseq \
  -customcfgdir ~/Downloads/beers_simulator_refseq \
  -outdir ~/Downloads/beers_output


=== Use [http://www.ncbi.nlm.nih.gov/books/NBK158900/ SRAToolKit] instead of wget to download ===
$ ls -lh beers_output
Don't use the ''wget'' command since it requires the specification of right http address.
total 3.9M
-rw-r--r-- 1 brb brb 1.8K Mar 16 15:25 simulated_reads2genes_testbeers.txt
-rw-r--r-- 1 brb brb 1.2M Mar 16 15:25 simulated_reads_indels_testbeers.txt
-rw-r--r-- 1 brb brb 1.6K Mar 16 15:25 simulated_reads_junctions-crossed_testbeers.txt
-rw-r--r-- 1 brb brb 2.7M Mar 16 15:25 simulated_reads_substitutions_testbeers.txt
-rw-r--r-- 1 brb brb 6.3K Mar 16 15:25 simulated_reads_testbeers.bed
-rw-r--r-- 1 brb brb  31K Mar 16 15:25 simulated_reads_testbeers.cig
-rw-r--r-- 1 brb brb  22K Mar 16 15:25 simulated_reads_testbeers.fa
-rw-r--r-- 1 brb brb  584 Mar 16 15:25 simulated_reads_testbeers.log


[http://www.ncbi.nlm.nih.gov/books/NBK158899/ Downloading SRA data using command line utilities]
$ wc -l simulated_reads2genes_testbeers.txt
 
102 simulated_reads2genes_testbeers.txt
[https://github.com/NCBI-Hackathons/SRA2R SRA2R] - a package to import SRA data directly into R.
$ head -4 simulated_reads2genes_testbeers.txt
 
seq.1 GENE.5600
(Method 1) Use the '''[http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=toolkit_doc&f=fastq-dump fastq-dump]''' command. For example, the following command (modified from the [http://www.ncbi.nlm.nih.gov/books/NBK158899/#SRA_download.downloading_sra_data_using document] will download the first 5 reads and save it to a file called <SRR390728.fastq> ('''NOT sra format)''' in the current directory.
seq.2 GENE.35506
<syntaxhighlight lang='bash'>
seq.3 GENE.506
/opt/RNA-Seq/bin/sratoolkit.2.3.5-2-ubuntu64/bin/fastq-dump -X 5 SRR390728 -O .
seq.4 GENE.34922
# OR
$ tail -4 simulated_reads2genes_testbeers.txt
/opt/RNA-Seq/bin/sratoolkit.2.3.5-2-ubuntu64/bin/fastq-dump --split-3 SRR390728 # no progress bar
seq.97 GENE.4197
</syntaxhighlight>
seq.98 GENE.8763
This will download the files in FASTQ format.
seq.99 GENE.19573
 
seq.100 GENE.18830
(Method 2) If we need to downloading by wget or FTP (works for ‘SRR’, ‘ERR’, or ‘DRR’ series):
$ wc -l simulated_reads_indels_testbeers.txt
<syntaxhighlight lang='bash'>
36131 simulated_reads_indels_testbeers.txt
wget ftp://ftp-trace.ncbi.nih.gov/sra/sra-instant/reads/ByRun/sra/SRR/SRR304/SRR304976/SRR304976.sra
$ head -2 simulated_reads_indels_testbeers.txt
</syntaxhighlight>
chr1:6052304-6052531 25 1 G
It will download the file in SRA format. In the case of SRR590795, the sra is 240M and fastq files are 615*2MB.
chr2:73899436-73899622 141 3 ATA
$ tail -2 simulated_reads_indels_testbeers.txt
chr4:68619532-68621804 1298 -2 AA
chr21:32554738-32554962 174 1 T
$ wc -l simulated_reads_substitutions_testbeers.txt
71678  simulated_reads_substitutions_testbeers.txt
$ head -2 simulated_reads_substitutions_testbeers.txt
chr22:50902963-50903167 50903077 G->A
chr1:6052304-6052531 6052330 G->C
$ wc -l simulated_reads_junctions-crossed_testbeers.txt
49  simulated_reads_junctions-crossed_testbeers.txt
$ head -2 simulated_reads_junctions-crossed_testbeers.txt
seq.1a chrX:49084601-49084713
seq.1b chrX:49084909-49086682


(Method 3) Download Ubuntu x86_64 tarball from http://downloads.asperasoft.com/en/downloads/8?list
$ cat beers_output/simulated_reads_testbeers.log
<syntaxhighlight lang='bash'>
Simulator run: 'testbeers'
brb@T3600 ~/Downloads $ tar xzvf aspera-connect-3.6.2.117442-linux-64.tar.gz
started: Thu Mar 16 15:25:39 EDT 2017
aspera-connect-3.6.2.117442-linux-64.sh
num reads: 100
brb@T3600 ~/Downloads $ ./aspera-connect-3.6.2.117442-linux-64.sh
readlength: 100
 
substitution frequency: 0.001
Installing Aspera Connect
indel frequency: 0.0005
 
base error: 0.005
Deploying Aspera Connect (/home/brb/.aspera/connect) for the current user only.
low quality tail length: 10
Restart firefox manually to load the Aspera Connect plug-in
percent of tails that are low quality: 0
quality of low qulaity tails: 0.8
percent of alt splice forms: 0.2
number of alt splice forms per gene: 2
stem: refseq
sum of gene counts: 3,886,863,063
sum of intron counts = 1,304,815,198
sum of intron counts = 2,365,472,596
intron frequency: 0.355507598105262
padded intron frequency: 0.52453796437909
finished at Thu Mar 16 15:25:58 EDT 2017


Install complete.
$ wc -l simulated_reads_testbeers.fa
400 simulated_reads_testbeers.fa
$ head simulated_reads_testbeers.fa
>seq.1a
CGAAGAAGGACCCAAAGATGACAAGGCTCACAAAGTACACCCAGGGCAGTTCATACCCCATGGCATCTTGCATCCAGTAGAGCACATCGGTCCAGCCTTC
>seq.1b
GCTCGAGCTGTTCCTTGGACGAATGCACAAGACGTGCTACTTCCTGGGATCCGACATGGAAGCGGAGGAGGACCCATCGCCCTGTGCATCTTCGGGATCA
>seq.2a
GCCCCAGCAGAGCCGGGTAAAGATCAGGAGGGTTAGAAAAAATCAGCGCTTCCTCTTCCTCCAAGGCAGCCAGACTCTTTAACAGGTCCGGAGGAAGCAG
>seq.2b
ATGAAGCCTTTTCCCATGGAGCCATATAACCATAATCCCTCAGAAGTCAAGGTCCCAGAATTCTACTGGGATTCTTCCTACAGCATGGCTGATAACAGAT
>seq.3a
CCCCAGAGGAGCGCCACCTGTCCAAGATGCAGCAGAACGGCTACGAAAATCCAACCTACAAGTTCTTTGAGCAGATGCAGAACTAGACCCCCGCCACAGC


brb@T3600 ~/Downloads $ ~/.aspera/connect/bin/ascp -QT -l640M \
# Take a look at the true coordinates
  -i ~/.aspera/connect/etc/asperaweb_id_dsa.openssh \
$ head -4 simulated_reads_testbeers.bed # one-based coords and contains both endpoints of each span
  anonftp@ftp-private.ncbi.nlm.nih.gov:/sra/sra-instant/reads/ByRun/sra/SRR/SRR590/SRR590795/SRR590795.sra .
chrX 49084529 49084601 +
SRR590795.sra                                                                          100%  239MB  535Mb/s    00:06
chrX 49084713 49084739 +
Completed: 245535K bytes transferred in 7 seconds
chrX 49084863 49084909 +
(272848K bits/sec), in 1 file.
chrX 49086682 49086734 +
brb@T3600 ~/Downloads $
$ head -4 simulated_reads_testbeers.cig # has a cigar string representation of the mapping coordinates, and a more human readable representation of the coordinates
seq.1a chrX 49084529 73M111N27M 49084529-49084601, 49084713-49084739 + CGAAGAAGGACCCAAAGATGACAAGGCTCACAAAGTACACCCAGGGCAGTTCATACCCCATGGCATCTTGCATCCAGTAGAGCACATCGGTCCAGCCTTC
seq.1b chrX 49084863 47M1772N53M 49084863-49084909, 49086682-49086734 - GCTCGAGCTGTTCCTTGGACGAATGCACAAGACGTGCTACTTCCTGGGATCCGACATGGAAGCGGAGGAGGACCCATCGCCCTGTGCATCTTCGGGATCA
seq.2a chr1 183516256 100M 183516256-183516355 - GCCCCAGCAGAGCCGGGTAAAGATCAGGAGGGTTAGAAAAAATCAGCGCTTCCTCTTCCTCCAAGGCAGCCAGACTCTTTAACAGGTCCGGAGGAAGCAG
seq.2b chr1 183515275 100M 183515275-183515374 + ATGAAGCCTTTTCCCATGGAGCCATATAACCATAATCCCTCAGAAGTCAAGGTCCCAGAATTCTACTGGGATTCTTCCTACAGCATGGCTGATAACAGAT
$ wc -l simulated_reads_testbeers.fa
400 simulated_reads_testbeers.fa
$ wc -l simulated_reads_testbeers.bed
247 simulated_reads_testbeers.bed
$ wc -l simulated_reads_testbeers.cig
200 simulated_reads_testbeers.cig
</syntaxhighlight>
</syntaxhighlight>
''Aspera is typically 10 times faster than FTP'' according to the website. For this case, wget takes 12s while ascp uses 7s.


Note that the URL on the website's is wrong. I got the correct URL from emailing to ncbi help. Google: ascp "anonftp@ftp-private.ncbi.nlm.nih.gov"
=== [http://sammeth.net/confluence/display/SIM/Home Flux] Sammeth 2010 ===
 
=== [http://www.ebi.ac.uk/goldman-srv/simNGS/ SimNGS] ===
 
=== [http://cran.r-project.org/web/packages/SimSeq/index.html SimSeq]  ===
[http://bioinformatics.oxfordjournals.org/content/early/2015/02/26/bioinformatics.btv124.abstract Bioinformatics]


=== SRAdb package ===
A data-based simulation algorithm for rna-seq data. The vector of read counts simulated for a given experimental unit has a joint distribution that closely matches the distribution of a source rna-seq dataset provided by the user.
https://bioconductor.org/packages/release/bioc/html/SRAdb.html


First we install some required package for XML and RCurl.
=== [http://cran.r-project.org/web/packages/empiricalFDR.DESeq2/index.html empiricalFDR.DESeq2] ===
<syntaxhighlight lang='bash'>
http://biorxiv.org/content/early/2014/12/05/012211
sudo apt-get update
sudo apt-get install libxml2-dev
sudo apt-get install libcurl4-openssl-dev
</syntaxhighlight>
and then
<syntaxhighlight lang='rsplus'>
source("https://bioconductor.org/biocLite.R")
biocLite("SRAdb")
</syntaxhighlight>


== SRA ==
The key function is '''simulateCounts''', which takes a fitted DESeq2 data object as an input and returns a simulated data object (DESeq2 class) with the same sample size factors, total counts and dispersions for each gene as in real data, but without the effect of predictor variables.  
Only the cancer types with expected cases > 10^5 in the US in 2015 are considered here. http://www.cancer.gov/types/common-cancers


=== SRA Explorer ===
Functions fdrTable, fdrBiCurve and empiricalFDR compare the DESeq2 results obtained for the real and simulated data, compute the empirical false discovery rate (the ratio of the number of differentially expressed genes detected in the simulated data and their number in the real data) and plot the results.
* https://ewels.github.io/sra-explorer/
* Source code https://github.com/ewels/sra-explorer


=== SRP056969 ===
=== [http://www.bioconductor.org/packages/release/bioc/html/polyester.html polyester] ===
* [https://www.nature.com/articles/s41467-017-00867-z Inference of RNA decay rate from transcriptional profiling highlights the regulatory programs of Alzheimer’s disease]
http://biorxiv.org/content/early/2014/12/05/012211
* [http://www.rna-seqblog.com/rna-seq-reveals-mrna-stability-a-marker-in-alzheimers-patients/ RNA-Seq reveals mRNA stability a marker in Alzheimer’s patients]
* REMBRANDTS: REMoving Bias from Rna-seq ANalysis of Differential Transcript Stability


=== SRP066363 - lung cancer ===
Given a set of annotated transcripts, polyester will simulate the steps of an RNA-seq experiment (fragmentation, reverse-complementing, and sequencing) and produce files containing simulated RNA-seq reads.  
* Platform: GPL11154 Illumina HiSeq 2000 (Homo sapiens)
* Overall design: RNAseq and DNA copy number analysis of H1975 cells
* Strategy: 6 RNA-Seq and 3 Whole exome. Paired. [https://www.ncbi.nlm.nih.gov/sra?linkname=bioproject_sra_all&from_uid=302630 9 samples]
* http://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP066363
* http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE74866


=== SRP015769 or SRP062882 - prostate cancer ===
'''Input''': reference FASTA file (containing names and sequences of transcripts from which reads should be simulated) OR a GTF file denoting transcript structures, along with one FASTA file of the DNA sequence for each chromosome in the GTF file.
* http://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP015769 5 are from normal and 5 are from tumor. Whole Exome Seq.
* http://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP062882 6 normal and the rest are tumor.  


=== SRP053134 - breast cancer ===
'''Output''': FASTA files. Reads in the FASTA file will be labeled with the transcript from which they were simulated.
* http://www.ncbi.nlm.nih.gov/Traces/sra/?run=SRR1785051


Look at the MBases value column. It determines the coverage for each run.
Too many dependencies. <strike>Got an error in installation.</strike>. It seems it has not considered splice junctions.


=== [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE64016 SRP050992] single cell RNA-Seq ===
=== seqgendiff ===
Used in [https://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-0927-y Design and computational analysis of single-cell RNA-sequencing experiments]
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-3450-9 Data-based RNA-seq simulations by binomial thinning]
 
== Simulate DNA-Seq ==
* Software list - https://popmodels.cancercontrol.cancer.gov/gsr/packages/
* [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5224698/ A comparison of tools for the simulation of genomic next-generation sequencing data] Merly Escalona 2016


=== Single cell RNA-Seq ===
=== wgsim ===
* [http://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-0964-6 Exploiting single-cell expression to characterize co-expression replicability]
https://github.com/lh3/wgsim
* [[NGS#Single_Cell_RNA-Seq|NGS -> Single cell RNA-Seq]]


=== SRP040626 or SRP040540 - Colon and rectal cancer ===
* Used by [https://www.biorxiv.org/content/biorxiv/early/2017/12/20/237107.full.pdf#page=3 Cleaning clinical genomic data: Simple identification and removal of recurrently miscalled variants in single genomes] bioRxiv 2017
* http://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP040626
* [https://gatkforums.broadinstitute.org/gatk/discussion/7859/how-to-simulate-reads-using-a-reference-genome-alt-contig (How to) Simulate reads using a reference genome ALT contig]
* http://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP040540
* [http://research.cs.wisc.edu/wham/comparison-using-wgsim/ Comparing WHAM with BWA using wgsim
* http://biobits.org/samtools_primer.html


=== OmicIDX ===
=== dwgssim ===
[https://seandavi.github.io/2019/06/omicidx-on-bigquery/ OmicIDX on BigQuery]
* [https://github.com/nh13/dwgsim Whole Genome Simulator for Next-Generation Sequencing]
* Example: [https://www.bioinformatics.recipes/recipe/view/recipe-variants-bcftools/#info How to generate variant calls with bcftools]


== Tutorials ==
=== NEAT ===
See the [[#BWA|BWA]] section.  
* https://github.com/zstephens/neat-genreads
* [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5125660/ Simulating next-generation sequencing datasets from empirical mutation and sequencing models] Zachary Stephens, 2016
* If I set 10 as the coverage rate and read length 101, the generated fq file is about 34GB (3.3GB * 10) for each one of the pairs.


== Whole Exome Seq ==
=== DNA aligner accuracy: BWA, Bowtie, Soap and SubRead tested with simulated reads ===
* [http://www.1000genomes.org/category/exome 1000genomes]. 1000genomes and tcga are two places to get vcf files too.
http://genomespot.blogspot.com/2014/11/dna-aligner-accuracy-bwa-bowtie-soap.html
* [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4179624/ Review of Current Methods, Applications, and Data Management for the Bioinformatics Analysis of Whole Exome Sequencing] (Bao 2014)
 
* [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3083463/ A framework for variation discovery and genotyping using next-generation DNA sequencing data]. See the table 1 there.
<syntaxhighlight lang='bash'>
* Some data from SRA repository.
$ head simDNA_100bp_16del.fasta
** http://sra.dnanexus.com/?q=cancer+exome&result_type=Study
>Pt-0-100
** http://www.ncbi.nlm.nih.gov/sra/?term=WXS
TGGCGAACGCGGGAATTGACCGCGATGGTGATTCACATCACTCCTAATCCACTTGCTAATCGCCCTACGCTACTATCATTCTTT
** [http://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP008740 SRP008740] See [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3956068/ A survey of tools for variant analysis of next-generation sequencing data] (Pabinger 2014)
>Pt-10-110
GCGGGATTGAACCCGATTGAATTCCAATCACTGCTTAATCCACTTGCTACATCGCCCTACGTACTATCTATTTTTTTGTATTTC
>Pt-20-120
GAACCCGCGATGAATTCAATCCACTGCTACCATTGGCTACATCCGCCCCTACGCTACTCTTCTTTTTTGTATGTCTAAAAAAAA
>Pt-30-130
TGGTGAATCACAATCACTGCCTAACCATTGGCTACATCCGCCCCTACGCTACACTATTTTTTGTATTGCTAAAAAAAAAAATAA
>Pt-40-140
ACAACACTGCCTAATCCACTTGGCTACTCCGCCCCTAGCTACTATCTTTTTTTGTATTTCTAAAAAAAAAAAATCAATTTCAAT
</syntaxhighlight>


== Whole Genome Seq ==
=== Simulate Whole genome ===
* [https://www.ncbi.nlm.nih.gov/bioproject/browse/ BioProject] and
* [https://github.com/nh13/dwgsim DWGSIM] mentioned by [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3785481/ Variant Callers for Next-Generation Sequencing Data: A Comparison Study]. For its usage, see http://davetang.org/wiki/tiki-index.php?page=DWGSIM
** Search: filter by 'Homo sapiens wgs'
 
** Project data type: Genome sequencing
=== Simulate whole exome ===
** Click 'Date' to sort by it
* https://www.biostars.org/p/66714/ (no final answer)
** 20 hits as of 1/11/2017 (many of them do not have data)
* [https://academic.oup.com/bioinformatics/article/29/8/1076/225073 Wessim: a whole-exome sequencing simulator based on in silico exome capture] Sangwoo Kim 2013 & [http://sak042.github.io/Wessim/ software]
* [https://www.ncbi.nlm.nih.gov/bioproject/PRJNA352450 PRJNA352450] 18 experiments
** [https://www.ncbi.nlm.nih.gov/sra/SRX2341045 SRX2341045] 20.5M spots, 4.1G bases, 1.8Gb
* [https://www.ncbi.nlm.nih.gov/bioproject/PRJNA343545 PRJNA343545] 48 experiments
** [https://www.ncbi.nlm.nih.gov/sra/SRX2187657 SRX2187657] 417.4M spots, 126.1G bases, 55.1Gb
* [https://www.ncbi.nlm.nih.gov/bioproject/309109 309109] 5 experiments
** [https://www.ncbi.nlm.nih.gov/sra/SRX1538498 SRX1538498] 1.7M spots, 346.1M bases, 99.7Mb
* [https://www.ncbi.nlm.nih.gov/bioproject/PRJNA289286 PRJNA289286] 5 experiments
** [https://www.ncbi.nlm.nih.gov/sra/SRX1100298 SRX1100298] 504M spots, 101.8G bases, 45.3Gb
* [https://www.ncbi.nlm.nih.gov/bioproject/PRJNA260389 PRJNA260389] 27 experiments
** [https://www.ncbi.nlm.nih.gov/sra/SRX699196 SRX699196] 34,099,675 spots, 6.8G bases, 4.3Gb size
* [https://www.ncbi.nlm.nih.gov/bioproject/248553 248553] 3 experiments
** [https://www.ncbi.nlm.nih.gov/sra/SRX1026041 SRX1026041] 1.2G spots, 250.9G bases, 114.2Gb
* [https://www.ncbi.nlm.nih.gov/bioproject/210123 210123] 26 experiments
** [https://www.ncbi.nlm.nih.gov/sra/SRX318496 SRX318496] 173.7M spots, 34.7G bases, 23Gb
* [https://www.ncbi.nlm.nih.gov/bioproject/43433 43433] 3 experiments (ABI SOLiD System 3.0)
** [https://www.ncbi.nlm.nih.gov/sra/SRX017230 SRX017230]  851.1M spots, 85.1G bases, 68.8Gb


== SraRunTable.txt ==
=== SCSIM ===
# http://www.ncbi.nlm.nih.gov/sra/?term=SRA059511
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-03550-1 SCSIM: Jointly simulating correlated single-cell and bulk next-generation DNA sequencing data]
# http://www.ncbi.nlm.nih.gov/sra/SRX194938[accn] and click ''SRP004077''
# http://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP004077 and click '''Runs''' from the RHS
# http://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP004077 and click '''RunInfoTable'''


Note that (For this study, it has 2377 rows)
== Variant simulator ==
* Column A (AssemblyName_s) eg GRCh37
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2611-1 sim1000G: a user-friendly genetic variant simulator in R for unrelated individuals and family-based designs]
* Column I (library_name_s) eg
* column N (header=Run_s) shows all SRR or ERR accession numbers.  
* Column P (Sample_Name)
* Column Y (header=Assay_Type_s) shows '''WGS'''.  
* Column AB (LibraryLayout_s): PAIRED


= Public Data =
== Mutation-Simulator ==
[https://waldronlab.io/PublicDataResources/ Public data resources and Bioconductor] from [https://bioc2020.bioconductor.org/workshops.html Bioc2020].
[https://github.com/mkpython3/Mutation-Simulator Mutation-Simulator]


{| class="wikitable"
== SigProfilerSimulator ==
|-
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-03772-3 Generating realistic null hypothesis of cancer mutational landscapes using SigProfilerSimulator]
! Package name
! Object class
! Downloads (Distinct IPs, Jul 2020)
|-
| [https://www.bioconductor.org/packages/release/bioc/html/GEOquery.html GEOquery]
| SummarizedExperiment
| 5754
|-
| [https://www.bioconductor.org/packages/release/bioc/html/GenomicDataCommons.html GenomicDataCommons]
| GDCQuery
| 1154
|-
| [https://www.bioconductor.org/packages/release/bioc/html/TCGAbiolinks.html TCGAbiolinks]<br />[https://www.bioconductor.org/packages/release/data/experiment/html/curatedTCGAData.html curatedTCGAData]
| RangedSummarizedExperiment<br />MultiAssayExperimentObjects
| 2752 <br />275
|-
| [http://www.bioconductor.org/packages/release/bioc/html/recount.html recount]
| RangedSummarizedExperiment
| 418
|-
| [https://www.bioconductor.org/packages/release/data/experiment/html/curatedMetagenomicData.html curatedMetagenomicData]
| ExperimentHub
| 224
|}


== ISB Cancer Genomics Cloud (ISB-CGC) ==
== Convert FASTA to FASTQ ==
https://isb-cgc.appspot.com/ Leveraging Google Cloud Platform for TCGA Analysis
It is interesting to note that the simulated/generated FASTA files can be used by alignment/mapping tools like BWA just like FASTQ files.


The ISB Cancer Genomics Cloud (ISB-CGC) is democratizing access to NCI Cancer Data (TCGA, TARGET, CCLE) and coupling it with unprecedented computational power to allow researchers to explore and analyze this vast data-space.
If we want to convert FASTA files to FASTQ files, use https://code.google.com/archive/p/fasta-to-fastq/. The quality score 'I' means 40 (the highest) by Sanger (range [0,40]). See https://en.wikipedia.org/wiki/FASTQ_format. The Wikipedia website also mentions FASTQ read simulation tools and a comparison of these tools.


[https://github.com/isb-cgc/ISB-CGC-Webapp ISB-CGC Web Application]
<syntaxhighlight lang='bash'>
$ cat test.fasta
>Pt-0-50
TGGCGAACGACGGGAATACCCGGAGGTGAATTCAAATCCACT
>Pt-10-60
GACGGAATTGAACCCGATGGGATACAATCCACTGCCTTATCC
>Pt-20-70
GAACCCGCGATGGTGTCACAATCCACTCTTAACCATTGCTAC
>Pt-30-80
GGTGAATTCACAATCCACTGCCTTACCACTTGGCTACCCCCT
>Pt-40-90
AATCCACTGCCTTATCCACTGGCTACATCCCTACGCTACTAT
$ perl ~/Downloads/fasta_to_fastq.pl test.fasta
@Pt-0-50
TGGCGAACGACGGGAATACCCGGAGGTGAATTCAAATCCACT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@Pt-10-60
GACGGAATTGAACCCGATGGGATACAATCCACTGCCTTATCC
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@Pt-20-70
GAACCCGCGATGGTGTCACAATCCACTCTTAACCATTGCTAC
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@Pt-30-80
GGTGAATTCACAATCCACTGCCTTACCACTTGGCTACCCCCT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@Pt-40-90
AATCCACTGCCTTATCCACTGGCTACATCCCTACGCTACTAT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
</syntaxhighlight>


== CCLE ==
Alternatively we can use just one line of code by [https://www.reddit.com/r/bioinformatics/comments/32pu00/fasta_to_fastq_converter/ awk]
[https://www.nature.com/articles/s41586-019-1186-3 Next-generation characterization of the Cancer Cell Line Encyclopedia] 2019
<syntaxhighlight lang='sh'>
 
$ awk 'BEGIN {RS = ">" ; FS = "\n"} NR > 1 {print "@"$1"\n"$2"\n+"; for(c=0;c<length($2);c++) printf "H"; printf "\n"}' \
It has 1000+ cell lines profiled with different -omics including DNA methylation, RNA splicing, as well as some proteomics (and lots more!).ß
  test.fasta > test.fq
$ cat test.fq
@Pt-0-50
TGGCGAACGACGGGAATACCCGGAGGTGAATTCAAATCCACT
+
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
@Pt-10-60
GACGGAATTGAACCCGATGGGATACAATCCACTGCCTTATCC
+
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
@Pt-20-70
GAACCCGCGATGGTGTCACAATCCACTCTTAACCATTGCTAC
+
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
@Pt-30-80
GGTGAATTCACAATCCACTGCCTTACCACTTGGCTACCCCCT
+
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
@Pt-40-90
AATCCACTGCCTTATCCACTGGCTACATCCCTACGCTACTAT
+
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
</syntaxhighlight>
Change the 'H' to the quality score value that you need (Depending what phred score scale you are using).


== NCI's Genomic Data Commons (GDC)/TCGA ==
== Simulate genetic data ==
The GDC supports several cancer genome programs at the NCI Center for Cancer Genomics (CCG), including The Cancer Genome Atlas (TCGA), Therapeutically Applicable Research to Generate Effective Treatments (TARGET), and the Cancer Genome Characterization Initiative (CGCI).
[https://onunicornsandgenes.blog/2019/06/16/simulating-genetic-data-with-r-an-example-with-deleterious-variants-and-a-pun/ ‘Simulating genetic data with R: an example with deleterious variants (and a pun)’]


* [https://portal.gdc.cancer.gov/ NCI's GDC] - Genomic Data Commons Data Portal. Researchers can access over 3 PB of bigData from projects like CPTAC, TARGET and of course TCGA.
= PDX/Xenograft =
** [https://gdc.cancer.gov/support/gdc-webinars GDC webinars]
* https://en.wikipedia.org/wiki/Patient_derived_xenograft
** [https://gdc.cancer.gov/resources-tcga-users/tcga-code-tables/tcga-study-abbreviations Study Abbreviations]
* [https://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-15-1172 Are special read alignment strategies necessary and cost-effective when handling sequencing reads from patient-derived tumor xenografts?] by Tso et al, BMC Genomics, 2014.
* [https://tcpaportal.org/tcpa/download.html MDAnderson] download, [https://tcpaportal.org/tcpa/faq.html FAQ], [https://bioinformatics.mdanderson.org/public-software/tcpa/ Available Software]
* [http://www.arrayserver.com/wiki/index.php?title=Align_Ion_Torrent_reads Map xenograft reads] by [http://www.omicsoft.com/array-studio/ Array Suite]
* [https://bioconductor.org/packages/release/bioc/vignettes/TCGAbiolinks/inst/doc/tcgaBiolinks.html#tcgaanalyze_dea__tcgaanalyze_leveltab:_differential_expression_analysis_(dea) Working with TCGAbiolinks package]
* [http://www.pdxfinder.org/ PDXFinder] includes PDMR as one of 6 providers. The website source code https://github.com/PDXFinder/pdxfinder.
** edgeR is used to find DE; see the TCGAanalyze_DEA() function and [https://www.bioconductor.org/packages/release/bioc/vignettes/TCGAbiolinks/inst/doc/analysis.html#TCGAanalyze_DEA__TCGAanalyze_LevelTab:_Differential_expression_analysis_(DEA) TCGAanalyze: Analyze data from TCGA]
** [http://www.pdxfinder.org/data/pdx/IRCC/CRC0120LM#variation A Colorectal Carcinoma example] contains 'genomic data'. Each row represents one seq position. No raw FASTQ files available.
* [https://bioconductor.org/packages/release/data/experiment/html/GSE62944.html GEO accession data GSE62944 as a SummarizedExperiment] and [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE62944 GEO] website.
* NCI [https://pdmr.cancer.gov/database/default.htm Patient-Derived Models Repository (PDMR)].
* [https://www.ncbi.nlm.nih.gov/pubmed/25819073 BioXpress: an integrated RNA-seq-derived gene expression database for pan-cancer analysis.]
** '''passage number''' (P0 represented first '''implant'''). [https://bitesizebio.com/13685/cell-culture-passage-number-explained/ Understanding Cell Passage Number and How to Calculate it for Cell Cultures]. A passage number refers to the '''number of times''' a culture of cells has been '''sub-cultivated''' or transferred to a new environment. For example, if a culture of cells is started and then '''split''' into two new cultures, each of these new cultures would be considered a "passage 2" culture. The original culture would be considered "passage 1." This is commonly used in in-vitro cell culture studies to track the age, growth, and changes of the cells over time. It is also used to ensure the consistent quality of the cells or organisms being used in experiments.
* https://github.com/srp33/TCGA_RNASeq_Clinical
** ftp://dctdftp.nci.nih.gov/pub/pdm/
* [https://www.biorxiv.org/content/early/2018/12/21/046904 MOGSA: integrative single sample gene-set analysis of multiple omics data] 2019. The data was obtained from TCGA and NCI60.
** The ftp link can be obtained by clicking 'PDMR Models' -> 'PDMR database' -> Click here to access the PDMR Database -> 'Genomic Analysis'.
* [https://cancerres.aacrjournals.org/content/79/13/3514 RNA Sequencing of the NCI-60: Integration into CellMiner and CellMiner CDB]
** There will be three tabs: NCI Cancer Genome Panel (4246 records), Whole Exome Sequence (785 records) and RNASeq (807 records).
* [https://www.tandfonline.com/doi/abs/10.1080/01621459.2020.1730853?journalCode=uasa20 Integrating Multidimensional Data for Clustering Analysis With Applications to Cancer Patient Data] 2020
** For Whole Exome Sequence, '''VCF''' was provided. For RNASeq, '''RSEM''' files per genes or isoforms are available.
 
** The '''RNASeq Transcriptome Data Analysis Pipeline and Specifications''' and '''Whole Exome Sequencing Data Analysis Pipeline and Specifications''' are available under SOPs. [https://pdmdb.cancer.gov/pls/apex/f?p=101:34:0::NO:34:: RNASeq] TPM data.
=== GenomicDataCommons package ===
* [https://www.rna-seqblog.com/reproducible-bioinformatics-project/ Reproducible Bioinformatics Project]
* [[#GenomicDataCommons_package|See here]]
* [https://academic.oup.com/bioinformatics/article/28/12/i172/269972 Xenome] a tool for classifying reads from xenograft samples, Thomas Conway et al 2012.
* [https://seandavi.github.io/post/2017/12/genomicdatacommons-example-uuid-to-tcga-and-target-barcode-translation/ GenomicDataCommons] Example: UUID to TCGA and TARGET Barcode Translation
** [https://en.wikipedia.org/wiki/K-mer K-mer]
 
** The program is bundled in '''[https://github.com/data61/gossamer/blob/master/docs/xenome.md Gossamer]''' (Github)
=== Case studies ===
** [https://hpc.nih.gov/apps/gossamer.html Biowulf] It is noted that Gossamer runs in a Singularity container
[https://link.springer.com/content/pdf/10.1186/s40249-020-00662-x.pdf Expression of the SARS-CoV-2 cell receptor gene ACE2 in a wide variety of human tissues]
** Indexing took 13 hours when I set 16 threads and 24GB memory (25.4GB was used). A set of 23 files with prefix 'idx' will be generated.
 
: <syntaxhighlight lang='bash'>
== NCI Proteomic Data Commons ==
#!/bin/bash
https://pdc.cancer.gov/pdc/
module load gossamer
xenome index -M 24 -T 16 -P idx \
  -H $HOME/igenomes/Mus_musculus/UCSC/mm9/Sequence/WholeGenomeFasta/genome.fa \
  -G $HOME/igenomes/Homo_sapiens/UCSC/hg19/Sequence/WholeGenomeFasta/genome.fa
</syntaxhighlight>
* [http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0074432 Next-Generation Sequence Analysis of Cancer Xenograft Models] by Fernando J. Rossello et al 2013.
* [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4991491/ Whole transcriptome profiling of patient-derived xenograft models as a tool to identify both tumor and stromal specific biomarkers] Bradford et al 2016
* [https://f1000research.com/articles/5-2741/v1 An open-source application for disambiguating two species in next generation sequencing data from grafted samples] by Ahdesmäki MJ et al 2016. [https://github.com/AstraZeneca-NGS/disambiguate Disambiguation]
* [http://mcr.aacrjournals.org/content/molcanres/15/8/1012.full.pdf Next-Generation Sequencing Analysis and Algorithms for PDX and CDX Models] by Garima Khandelwal et al 2017. [https://github.com/CRUKMI-ComputationalBiology/bamcmp bamcmp] software.
* [https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-017-4414-y Computational approach to discriminate human and mouse sequences in patient-derived tumour xenografts] by Maurizio Callari et al 2018. Both RNA-Seq and DNA-Seq are considered. Software [https://github.com/cclab-brca/ICRG ICRG].
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2353-5 XenofilteR: computational deconvolution of mouse and human reads in tumor xenograft sequence data] Kluin et al 2018. Software in [https://github.com/PeeperLab/XenofilteR github].
* [https://hpc.nih.gov/apps/bbtools.html BBSplit], [https://pdmr.cancer.gov/content/docs/MCCRD_SOP0011_PDX_Whole_Exome_Seq_Analysis_Pipeline.pdf PDX Whole Exome Seq Analysis Pipeline], [https://pdmr.cancer.gov/content/docs/MCCRD_SOP0012_PDX_RNASeq_Analysis_Pipeline.pdf RNASeq Transciptome Data Analysis Pipeline] from PDMR. [https://www.biostars.org/p/143019/ Tool to separate human and mouse rna seq reads].
* [https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1006596 Whole genomes define concordance of matched primary, xenograft, and organoid models of pancreas cancer] Gendoo et al 2019
* [https://cancerres.aacrjournals.org/content/79/17/4539 Integrative Pharmacogenomics Analysis of Patient-Derived Xenografts] 2019
* [https://pubmed.ncbi.nlm.nih.gov/31262303/ Genomic data analysis workflows for tumors from patient-derived xenografts (PDXs): challenges and guidelines] 2019
* [https://bioconductor.org/packages/release/bioc/html/Xeva.html Xeva] package. Analysis of patient-derived xenograft (PDX) data. Paper [https://aacrjournals.org/cancerres/article/79/17/4539/638195/Integrative-Pharmacogenomics-Analysis-of-Patient Integrative Pharmacogenomics Analysis of Patient-Derived Xenografts] Mer, 2019. ''Molecular profile and pharmacologic profile''.
** GSE78806 - microarray-based Gene expression data, PDX passages, and tissue information
** [https://www.nature.com/articles/nm.3954 High-throughput screening using patient-derived tumor xenografts to predict clinical trial drug response] Gao, 2015. Molecular profiles including mutation, CNA, RNASeq-based gene expression, and pharmacologic profiles.


== GTEx ==
== RNA-Seq ==
* [https://www.gtexportal.org/home/ Genotype-Tissue Expression (GTEx) project]  
* [https://pdmr.cancer.gov/content/docs/MCCRD_SOP0012_PDX_RNASeq_Analysis_Pipeline.pdf RNASeq Transciptome Data Analysis Pipeline and Specifications] by Mocha
* [https://master.bioconductor.org/packages/release/workflows/html/recountWorkflow.html recount workflow: accessing over 70,000 human RNA-seq samples with Bioconductor]
*# ''PDX Mouse reads are removed from the raw FASTQ files using bbsplit (bbtools v37.36).''
* [https://www.biorxiv.org/content/10.1101/602367v1 Basal Contamination of Bulk Sequencing: Lessons from the GTEx dataset]
*# The fastq files are mapped to human transcriptome based on exon models from hg19 using Bowtie2 (version 2.2.6) [1]. The resulting SAM files are converted to BAM forma using samtools [2] and the coordinations in BAM are converted to the genomic (hg19) coordinations using RSEM (version 1.2.31). Gene and transcript quantifications are also done using RSEM.
*# Removal of Small nucleolar RNAs (snoRNAs)
* Platform [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GPL16791 GPL16791] Illumina HiSeq 2500
** https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM1702792
** https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM1887215
* [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GPL25431 GPL25431] Illumina HiSeq 4000 (Homo sapiens; Mus musculus)
** GSE118197
* [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GPL18573 GPL18573] Illumina NextSeq 500
** GSE106336  [https://www.nature.com/articles/s41467-017-01967-6 MYC] regulates ductal-neuroendocrine lineage plasticity in pancreatic ductal adenocarcinoma associated with poor outcome and chemoresistance
* [https://youtu.be/j4qpJ8sVjT0 Mastering RNA-Seq (NGS Data Analysis) - A Critical Approach To Transcriptomic Data Analysis]. This is posted on [https://www.rna-seqblog.com/mastering-rna-seq-data-analysis-a-critical-approach-to-transcriptomic-data-analysis/ rna-seqblog]. See the link [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4991491/ Whole transcriptome profiling of patient-derived xenograft models as a tool to identify both tumor and stromal specific biomarkers].
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-03633-z PDXGEM]: patient-derived tumor xenograft-based gene expression model for predicting clinical response to anticancer therapy in cancer patients
* [https://github.com/qianzhulab/Xenomake Xenomake]: Processing pipeline for Patient Derived Xenograft (PDX) Spatial Transcriptomics Datasets


== DepMap ==
== DNA-Seq ==
* [https://depmap.org/portal/ Dependency Map (DepMap)] portal is to empower the research community to make discoveries related to cancer vulnerabilities by providing open access to key cancer dependencies analytical and visualization tools.
* [http://www.sciencedirect.com/science/article/pii/S2211124713004634 Endocrine-Therapy-Resistant ESR1 Variants Revealed by Genomic Characterization of Breast-Cancer-Derived Xenografts]  
** [https://depmap.org/portal/ccle/ CCLE]
** [https://www.ncbi.nlm.nih.gov/projects/gap/cgi-bin/molecular.cgi?study_id=phs000611.v1.p1&phv=195714&phd=&pha=&pht=3502&phvf=&phdf=&phaf=&phtf=&dssp=1&consent=&temp=1 dbGaP]
<ul>
** GaP accession [https://trace.ncbi.nlm.nih.gov/Traces/study/?acc=phs000611 phs000611].
<li>[https://bioconductor.org/packages/release/data/experiment/html/depmap.html depmap]: Cancer Dependency Map Data Package. The depmap package currently contains eight (kinds) datasets available through [http://www.bioconductor.org/packages/release/bioc/html/ExperimentHub.html ExperimentHub].
* https://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=xenograft&go=Go
* RNA inference knockout data
* [https://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?study=ERP021871 ERP021871]
* CRISPR-Cas9 knockout data
* WES copy number data
* CCLE Reverse Phase Protein Array data
* CCLE RNAseq gene expression data
* Cancer cell lines
* Mutation calls
* Drug Sensitivity
<pre>
R> eh <- ExperimentHub()
R> class(eh)
[1] "ExperimentHub"
attr(,"package")
[1] "ExperimentHub"


R> rnai <- eh[["EH2260"]]
== MAF (TCGA, GDC) ==
R> class(rnai)
* See [https://brb.nci.nih.gov/d3oncoprint/D3Oncoprint-UserManual.pdf#page=17 D3Oncoprint] manual. D3oncoprint uses java to create the interface (java -jar D3Oncoprint.jar). The result is shown in a browser. The top part is a heatmap and the bottom part is a table. The heatmap is good only for a small number of variants and there is no way to zoom in if we have a lot of variants (eg 1000). The phenotypes file is optional. The following 3 columns are required and the others are for tooltip and table. The column name from a VCF file input is given below.
[1] "tbl_df"    "tbl"        "data.frame"
** '''Gene column''': GENE
</pre>
** '''Variant type column''': ExonicFunc.refGene
</li>
** '''Aminoacid change column''': AAChange.refGene (this defines the name of '''variant'''. The variant uses the single letter aminoacid codes. This information is only used in HTML table. For example if AAChange.refGene=UGT1A7:NM_019077:exon1:c.T387G:p.N129K, then the variant will be N129K. My observation is the variant name for variant type 'frameshift_deletion' is altered in table; R128fs -> R128Xfs)
</ul>
* https://www.reddit.com/r/bioinformatics/comments/cmdza5/vcf_and_maf_file_formats/ which links to
** MAF: https://docs.gdc.cancer.gov/Data/File_Formats/MAF_Format/
** VCF: https://gatk.broadinstitute.org/hc/en-us/articles/360035531692?id=11005
** [https://www.reddit.com/r/bioinformatics/comments/cmdza5/vcf_and_maf_file_formats/ VCF and MAF file formats?]
* [https://pdmr.cancer.gov/content/docs/MCCRD_SOP0023_v2.0_PDX_consensus_files.pdf The Standing Operating Procedure (SOP) describes procedures for generating consensus/intersect variants calls for reporting in the NCI Patient-Derived Models database]
* Convert vcf to maf. https://hpc.nih.gov/apps/vcf2maf.html
* [https://www.bioconductor.org/packages/release/bioc/vignettes/maftools/inst/doc/maftools.html#10_variant_annotations maftools] : Summarize, Analyze and Visualize MAF Files (oncoplots)
* https://www.bioconductor.org/packages/release/bioc/html/TCGAbiolinks.html
** [https://www.biostars.org/p/295833/ Use TCGAbiolinks package] to download maf file.
** http://firebrowse.org/. For example, BRCA -> Mutation Annotation File (from bar plot on RHS). Pick any data. The (extracted) file name will be *.maf.txt.


== NIH LINCS ==
= DNA Seq Data =
* http://www.lincsproject.org/, http://www.lincsproject.org/LINCS/tools
== NIH ==
* [https://bioconductor.org/packages/release/bioc/vignettes/slinky/inst/doc/LINCS-analysis.html slinky], [https://academic.oup.com/bioinformatics/article/35/17/3176/5284904 paper]
* Go to [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=search_obj SRA/Sequence Read Archive]and type the keywords 'Whole Genome Sequencing human'. An example of the procedures to search whole genome sequencing data from human samples:
* [https://bioconductor.org/packages/release/bioc/html/cmapR.html cmapR]
*# Enter 'Whole Genome Sequencing human' in ncbi/sra search sra objects at http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=search_obj
* [https://pubmed.ncbi.nlm.nih.gov/29065900/ GRcalculator: an online tool for calculating and mining dose-response data]
*# The webpage will return the result in terms of SRA experiments, SRA studies, Biosamples, GEO datasets. I pick SRA studies from Public Access.
* [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6381817/ Reproducible Bioconductor workflows using browser-based interactive notebooks and containers]
*# The result is sorted by the Accession number (does not take the first 3 letters like DRP into account). The Accession number has a format SRPxxxx. So I just go to the Last page (page 98)
*# I pick the first one Accession:SRP066837 from this page. The page shows the '''Study type''' is whole genome sequence. http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?study=SRP066837
*# <span style="color: red">(Important trick)</span> Click the number next to '''Run'''. It will show a summary (SRR #, library name, MBases, age, biomaterial provider, isolate and sex) about all samples. http://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP066837
*# Download the raw data from any one of them (eg SRR2968056). For whole genome, the '''Strategy''' is ''WGS''. For whole exome, the '''Strategy''' is called ''WXS''.
* Search the keywords 'nonsynonymous' and 'human' in [http://www.ncbi.nlm.nih.gov/pmc/?term=nonsynonymous+human PMC]


== Sharing data ==
=== Use [http://www.ncbi.nlm.nih.gov/books/NBK158900/ SRAToolKit] instead of wget to download ===
* [https://datascience.cancer.gov/data-sharing NCI Data Sharing]
Don't use the ''wget'' command since it requires the specification of right http address.
* [https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1006472 Ten quick tips for sharing open genomic data] Brown et al, PLOS 2018


= Gene set analysis =
[http://www.ncbi.nlm.nih.gov/books/NBK158899/ Downloading SRA data using command line utilities]
* [https://www.biostars.org/p/88926/ Over Representation Vs Enrichment Analysis]


== Hypergeometric test ==
[https://github.com/NCBI-Hackathons/SRA2R SRA2R] - a package to import SRA data directly into R.
* [http://mygoblet.org/training-portal/courses/pathway-and-network-analysis-omics-data-2014 A course from bioinformatics.ca] and [http://mygoblet.org/sites/default/files/materrials/Pathways_2014_Module2.pdf over-represented pathway].
* [http://blog.nextgenetics.net/?e=94 How informative are enrichment analyses really?]


== Next-generation sequencing data ==
(Method 1) Use the '''[http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=toolkit_doc&f=fastq-dump fastq-dump]''' command. For example, the following command (modified from the [http://www.ncbi.nlm.nih.gov/books/NBK158899/#SRA_download.downloading_sra_data_using document] will download the first 5 reads and save it to a file called <SRR390728.fastq> ('''NOT sra format)''' in the current directory.
* [http://bioinformatics.oxfordjournals.org/content/32/17/i611.full Gene-set association tests for next-generation sequencing data]
<syntaxhighlight lang='bash'>
/opt/RNA-Seq/bin/sratoolkit.2.3.5-2-ubuntu64/bin/fastq-dump -X 5 SRR390728 -O .
# OR
/opt/RNA-Seq/bin/sratoolkit.2.3.5-2-ubuntu64/bin/fastq-dump --split-3 SRR390728 # no progress bar
</syntaxhighlight>
This will download the files in FASTQ format.


= Forums =
(Method 2) If we need to downloading by wget or FTP (works for ‘SRR’, ‘ERR’, or ‘DRR’ series):
* Biostars source code https://github.com/ialbert/biostar-central
<syntaxhighlight lang='bash'>
* https://support.bioconductor.org/ (powered by Biostar too)
wget ftp://ftp-trace.ncbi.nih.gov/sra/sra-instant/reads/ByRun/sra/SRR/SRR304/SRR304976/SRR304976.sra
</syntaxhighlight>
It will download the file in SRA format. In the case of SRR590795, the sra is 240M and fastq files are 615*2MB.


= Misc =
(Method 3) Download Ubuntu x86_64 tarball from http://downloads.asperasoft.com/en/downloads/8?list
== Advice ==
<syntaxhighlight lang='bash'>
* [https://widdowquinn.github.io/ten_great_papers/ Ten great papers for biologists starting out in computational biology]
brb@T3600 ~/Downloads $ tar xzvf aspera-connect-3.6.2.117442-linux-64.tar.gz
* [https://github.com/nih-byob/presentations/tree/master/2019/01_bioinformatics_tips Bioinformatics advice I wish I learned 10 years ago] from NIH
aspera-connect-3.6.2.117442-linux-64.sh
brb@T3600 ~/Downloads $ ./aspera-connect-3.6.2.117442-linux-64.sh


== High Performance ==
Installing Aspera Connect
* https://www.youtube.com/watch?v=M3RVfv6lUtc NYCMC


== Cloud Computing ==
Deploying Aspera Connect (/home/brb/.aspera/connect) for the current user only.
* [https://github.com/VCCRI/Falco/ '''Falco''': A quick and flexible single-cell RNA-seq processing framework on the cloud]
Restart firefox manually to load the Aspera Connect plug-in
* [https://youtu.be/cP5rvWoJDOQ Getting started with Bioconductor in the cloud]
* [https://www.rna-seqblog.com/micloud-a-bioinformatics-cloud-for-seamless-execution-of-complex-ngs-data-analysis-pipelines/ miCloud]: a bioinformatics cloud for seamless execution of complex NGS data analysis pipelines


== Merge different datasets (different genechips) ==
Install complete.
* https://support.bioconductor.org/p/65506/


== Normalization ==
brb@T3600 ~/Downloads $ ~/.aspera/connect/bin/ascp -QT -l640M \
* [http://nar.oxfordjournals.org/content/early/2015/07/21/nar.gkv736.long How data analysis affects power, reproducibility and biological insight of RNA-seq studies in complex datasets] 2015
  -i ~/.aspera/connect/etc/asperaweb_id_dsa.openssh \
* [http://www.biomedcentral.com/1471-2105/16/347 Comparing the normalization methods for the differential analysis of Illumina high-throughput RNA-Seq data] 2015
  anonftp@ftp-private.ncbi.nlm.nih.gov:/sra/sra-instant/reads/ByRun/sra/SRR/SRR590/SRR590795/SRR590795.sra .
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2382-0 Expression analysis of RNA sequencing data from human neural and glial cell lines depends on technical replication and normalization methods] 2018
SRR590795.sra                                                                          100%  239MB  535Mb/s    00:06
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2745-1 A statistical normalization method and differential expression analysis for RNA-seq data between different species] Zhou 2019
Completed: 245535K bytes transferred in 7 seconds
* [https://github.com/crazyhottommy/RNA-seq-analysis RNA-seq analysis] some notes from Ming Tang
(272848K bits/sec), in 1 file.
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-3247-x A protocol to evaluate RNA sequencing normalization methods] Abrams et al 2019. It concluded that transcripts per million ('''TPM''') was the best performing normalization method based on its preservation of biological signal as compared to the other methods tested.
brb@T3600 ~/Downloads $
* [https://bioconductor.github.io/BiocWorkshops/rna-seq-analysis-is-easy-as-1-2-3-with-limma-glimma-and-edger.html#data-pre-processing Data pre-processing] 6.6.3 Normalising gene expression distributions. log2 CPM (counts per million) was considered. edgeR::calcNormFactors(x, method = "TMM") was used to normalize counts.
</syntaxhighlight>
* [https://morphoscape.wordpress.com/2020/09/26/generalized-linear-models-and-plots-with-edger-advanced-differential-expression-analysis/ Generalized Linear Models and Plots with edgeR – Advanced Differential Expression Analysis]
''Aspera is typically 10 times faster than FTP'' according to the website. For this case, wget takes 12s while ascp uses 7s.
* [https://www.nature.com/articles/srep18898 CrossNorm: a novel normalization strategy for microarray data in cancers] Cheng 2016
* [https://rdrr.io/bioc/EnrichmentBrowser/man/normalize.html EnrichmentBrowser::normalize()]
* [https://compgenomr.github.io/book/gene-expression-analysis-using-high-throughput-sequencing-technologies.html#within-sample-normalization-of-the-read-counts 8.3.4 Within sample normalization of the read counts] and [https://compgenomr.github.io/book/gene-expression-analysis-using-high-throughput-sequencing-technologies.html#computing-different-normalization-schemes-in-r 8.3.5 Computing different normalization schemes in R] from Computational Genomics with R by Altuna Akalin
** '''CPM''' is the simplest method. It addresses the '''sequencing depth''' bias by normalizing the read counts per gene by dividing each gene’s read count by a certain value and multiplying it by 10^6. There are 3 ways for the denominator: Total Counts Normalization, Upper Quartile Normalization and Median Normalization.
** Popular metrics that improve upon CPM are RPKM/FPKM (reads/fragments per kilobase of million reads) and TPM (transcripts per million).
** '''RPKM''' is obtained by dividing the CPM value by another factor, which is the length of the gene per kilobase. FPKM (substitute ''reads'' with ''fragments'') is the same as RPKM, but is used for paired-end reads. So RPKM differs from CPM by adding one step.
** '''TPM''' also controls for both the library size and the gene lengths, however, with the TPM method, the read counts are first normalized by the gene length (per kilobase), and then gene-length normalized values are divided by the sum of the gene-length normalized values and multiplied by 10^6.
** '''Library composition''' or '''RNA composition'''. In DESeq2 the read counts are normalized by computing size factors, which addresses the differences not only in the library sizes, but also the ''library compositions''. See [https://compgenomr.github.io/book/gene-expression-analysis-using-high-throughput-sequencing-technologies.html#differential-expression-analysis 8.3.7 Differential expression analysis]
*** [https://chipster.csc.fi/manual/deseq2.html This procedure corrects for library size and RNA composition bias, which can arise for example when only a small number of genes are very highly expressed in one experiment condition but not in the other].
*** [https://hbctraining.github.io/DGE_workshop_salmon/lessons/01_DGE_setup_and_overview.html DESeq2 first normalizes the count data to account for differences in library sizes and RNA composition between samples].
*** A few ''highly'' differentially expressed genes between samples, differences in the number of genes expressed between samples, or presence of contamination can skew some types of normalization methods. [https://hbctraining.github.io/DGE_workshop_salmon/lessons/02_DGE_count_normalization.html Introduction to DGE] gives a nice graphical illustration of RNA composition.
*** '''Sequencing bias detection''' from [https://www.bioconductor.org/packages/release/bioc/vignettes/NOISeq/inst/doc/NOISeq.pdf#page=12 RNA composition] from the NOISeq's vignette.
* [https://academic.oup.com/bib/article/19/5/776/3056951#supplementary-data Selecting between-sample RNA-Seq normalization methods from the perspective of their assumptions] Evans 2018. R code is in github. [http://www.bioconductor.org/packages/release/data/experiment/html/seqc.html seqc] package from Bioconductor.


== Ensembl ==
Note that the URL on the website's is wrong. I got the correct URL from emailing to ncbi help. Google: ascp "anonftp@ftp-private.ncbi.nlm.nih.gov"
* http://useast.ensembl.org/index.html
* [http://training.ensembl.org/exercises Training]
* Ensembl to gene symbol using [https://rdrr.io/bioc/tidybulk/man/ensembl_symbol_mapping.html ensembl_to_symbol()].
** [https://github.com/stemangiola/bioc_2020_tidytranscriptomics A Tidy Transcriptomics introduction to RNA sequencing analyses] (Bioc 2020).
** [https://www.biostars.org/p/239681/ "org.Hs.eg.db"] package
** [https://stackoverflow.com/a/58875340 "biomaRt"] package


Ensembl is a genome browser for vertebrate genomes that supports research in comparative genomics, evolution, sequence variation and transcriptional regulation. Ensembl annotate genes, computes multiple alignments, predicts regulatory function and collects disease data. Ensembl tools include BLAST, BLAT, BioMart and the Variant Effect Predictor (VEP) for all supported species.
=== SRAdb package ===
https://bioconductor.org/packages/release/bioc/html/SRAdb.html


== How to use [http://genome.ucsc.edu/cgi-bin/hgTables UCSC Table Browser] ==
First we install some required package for XML and RCurl.
* An instruction from [http://bitseq.github.io/howto/index BitSeq] software
<syntaxhighlight lang='bash'>
* [https://www.biostars.org/p/93011/ How To Get Bed File Containing Exons Of Canonical Transcripts And Their Corresponding Gene Symbols]
sudo apt-get update
* [https://www.biostars.org/p/156637/ Where to download refseq gene coding regions data?]
sudo apt-get install libxml2-dev
** http://genome.ucsc.edu/cgi-bin/hgTables OR
sudo apt-get install libcurl4-openssl-dev
** Download '''refGene.txt.gz''' file from UCSC directly using http links
</syntaxhighlight>
* [https://www.biostars.org/p/94823/ Where To Download Genome Annotation Including Exon, Intron, Utr, Intergenic Information?]
and then
<syntaxhighlight lang='rsplus'>
source("https://bioconductor.org/biocLite.R")
biocLite("SRAdb")
</syntaxhighlight>


[[:File:Tablebrowser.png]] [[:File:Tablebrowser2.png]]
== SRA ==
[https://ncbiinsights.ncbi.nlm.nih.gov/2021/05/27/nih-open-access-cloud-sra/ The wait is over… NIH’s Public Sequence Read Archive is now open access on the cloud]


Note
Only the cancer types with expected cases > 10^5 in the US in 2015 are considered here. http://www.cancer.gov/types/common-cancers
# the UCSC browser will return the output on browser by default. Users need to use the browser to save the file with self-chosen file name.
# the output does not have a header
# The bed format is explained in https://genome.ucsc.edu/FAQ/FAQformat.html#format1


If I select "Whole Genome", I will get a file with 75,893 rows. If I choose "Coding Exons", I will get a file with 577,387 rows.
=== SRA Explorer ===
<pre style="white-space: pre-wrap; /* CSS 3 */ white-space: -moz-pre-wrap; /* Mozilla, since 1999 */ white-space: -pre-wrap; /* Opera 4-6 */ white-space: -o-pre-wrap; /* Opera 7 */ word-wrap: break-word; /* IE 5.5+ */ " >
* https://ewels.github.io/sra-explorer/
$ wc -l hg38Tables.bed
* Source code https://github.com/ewels/sra-explorer
75893 hg38Tables.bed
$ head -2 hg38Tables.bed
chr1 67092175 67134971 NM_001276352 0 - 67093579 67127240 0 9 1429,70,145,68,113,158,92,86,42, 0,4076,11062,19401,23176,33576,34990,38966,42754,
chr1 201283451 201332993 NM_000299 0 + 201283702 201328836 0 15 453,104,395,145,208,178,63,115,156,177,154,187,85,107,2920, 0,10490,29714,33101,34120,35166,36364,36815,38526,39561,40976,41489,42302,45310,46622,
$ tail -2 hg38Tables.bed
chr22_KI270734v1_random 131493 137393 NM_005675 0 + 131645 136994 0 5 262,161,101,141,549, 0,342,3949,4665,5351,
chr22_KI270734v1_random 138078 161852 NM_016335 0 - 138479 161586 0 15 589,89,99,176,147,93,82,80,117,65,150,35,209,313,164, 0,664,4115,5535,6670,6925,8561,9545,10037,10335,12271,12908,18210,23235,23610,


$ wc -l hg38CodingExon.bed
=== SRP056969 ===
577387 hg38CodingExon.bed
* [https://www.nature.com/articles/s41467-017-00867-z Inference of RNA decay rate from transcriptional profiling highlights the regulatory programs of Alzheimer’s disease]
$ head -2 hg38CodingExon.bed
* [http://www.rna-seqblog.com/rna-seq-reveals-mrna-stability-a-marker-in-alzheimers-patients/ RNA-Seq reveals mRNA stability a marker in Alzheimer’s patients]
chr1 67093579 67093604 NM_001276352_cds_0_0_chr1_67093580_r 0 -
* REMBRANDTS: REMoving Bias from Rna-seq ANalysis of Differential Transcript Stability
chr1 67096251 67096321 NM_001276352_cds_1_0_chr1_67096252_r 0 -
 
$ tail -2 hg38CodingExon.bed
=== SRP066363 - lung cancer ===
chr22_KI270734v1_random 156288 156497 NM_016335_cds_12_0_chr22_KI270734v1_random_156289_r 0 -
* Platform: GPL11154 Illumina HiSeq 2000 (Homo sapiens)
chr22_KI270734v1_random 161313 161586 NM_016335_cds_13_0_chr22_KI270734v1_random_161314_r 0 -
* Overall design: RNAseq and DNA copy number analysis of H1975 cells
* Strategy: 6 RNA-Seq and 3 Whole exome. Paired. [https://www.ncbi.nlm.nih.gov/sra?linkname=bioproject_sra_all&from_uid=302630 9 samples]
* http://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP066363
* http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE74866


# Focus on one NCBI refseq (https://www.ncbi.nlm.nih.gov/nuccore/444741698)
=== SRP015769 or SRP062882 - prostate cancer ===
$ grep NM_001276352 hg38Tables.bed
* http://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP015769 5 are from normal and 5 are from tumor. Whole Exome Seq.
chr1 67092175 67134971 NM_001276352 0 - 67093579 67127240 0 9 1429,70,145,68,113,158,92,86,42, 0,4076,11062,19401,23176,33576,34990,38966,42754,
* http://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP062882 6 normal and the rest are tumor.
$ grep NM_001276352 hg38CodingExon.bed
chr1 67093579 67093604 NM_001276352_cds_0_0_chr1_67093580_r 0 -
chr1 67096251 67096321 NM_001276352_cds_1_0_chr1_67096252_r 0 -
chr1 67103237 67103382 NM_001276352_cds_2_0_chr1_67103238_r 0 -
chr1 67111576 67111644 NM_001276352_cds_3_0_chr1_67111577_r 0 -
chr1 67115351 67115464 NM_001276352_cds_4_0_chr1_67115352_r 0 -
chr1 67125751 67125909 NM_001276352_cds_5_0_chr1_67125752_r 0 -
chr1 67127165 67127240 NM_001276352_cds_6_0_chr1_67127166_r 0 -
</pre>


This can be compared to '''refGene'''(?) directly downloaded via http
=== SRP053134 - breast cancer ===
<pre style="white-space: pre-wrap; /* CSS 3 */ white-space: -moz-pre-wrap; /* Mozilla, since 1999 */ white-space: -pre-wrap; /* Opera 4-6 */ white-space: -o-pre-wrap; /* Opera 7 */ word-wrap: break-word; /* IE 5.5+ */ " >
* http://www.ncbi.nlm.nih.gov/Traces/sra/?run=SRR1785051
$ wget -c -O hg38.refGene.txt.gz http://hgdownload.soe.ucsc.edu/goldenPath/hg38/database/refGene.txt.gz
--2018-10-09 15:44:43--  http://hgdownload.soe.ucsc.edu/goldenPath/hg38/database/refGene.txt.gz
Resolving hgdownload.soe.ucsc.edu (hgdownload.soe.ucsc.edu)... 128.114.119.163
Connecting to hgdownload.soe.ucsc.edu (hgdownload.soe.ucsc.edu)|128.114.119.163|:80... connected.
HTTP request sent, awaiting response... 200 OK
Length: 7457957 (7.1M) [application/x-gzip]
Saving to: ‘hg38.refGene.txt.gz’


hg38.refGene.txt.gz                100%[===============================================================>]  7.11M  901KB/s    in 10s
Look at the MBases value column. It determines the coverage for each run.


2018-10-09 15:44:54 (708 KB/s) - ‘hg38.refGene.txt.gz’ saved [7457957/7457957]
=== [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE64016 SRP050992] single cell RNA-Seq ===
Used in [https://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-0927-y Design and computational analysis of single-cell RNA-sequencing experiments]


$ zcat hg38.refGene.txt.gz | wc -l
=== Single cell RNA-Seq ===
75893
* [http://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-0964-6 Exploiting single-cell expression to characterize co-expression replicability]
15:45PM /tmp$ zcat hg38.refGene.txt.gz | head -2
* [[NGS#Single_Cell_RNA-Seq|NGS -> Single cell RNA-Seq]]
1072 NM_003288 chr20 + 63865227 63891545 63865365 63889945 7 63865227,63869295,63873667,63875815,63882718,63889189,63889849, 63865384,63869441,63873816,63875875,63882820,63889238,63891545, 0 TPD52L2 cmpl cmpl 0,1,0,2,2,2,0,
1815 NR_110164 chr2 + 161244738 161249050 161249050 161249050 2 161244738,161246874, 161244895,161249050, 0 LINC01806 unk unk -1,-1,


$ zcat hg38.refGene.txt.gz | tail -2
=== SRP040626 or SRP040540 - Colon and rectal cancer ===
1006 NM_130467 chrX + 55220345 55224108 55220599 55224003 5 55220345,55221374,55221766,55222620,55223986, 55220651,55221463,55221875,55222746,55224108, 0 PAGE5 cmpl cmpl 0,1,0,1,1,
* http://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP040626
637 NM_001364814 chrY - 6865917 6874027 6866072 6872608 7 6865917,6868036,6868731,6868867,6870005,6872554,6873971, 6866078,6868462,6868776,6868909,6870053,6872620,6874027, 0 AMELY cmpl cmpl 0,0,0,0,0,0,-1,
* http://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP040540
</pre>


== Where to download reference genome ==
=== OmicIDX ===
* [http://hgdownload.cse.ucsc.edu/downloads.html UCSC] and [https://genome.ucsc.edu/goldenpath/help/twoBit.html twoBitToFa] to [https://www.biostars.org/p/9700/ UCSC] convert .2bit to fasta.
[https://seandavi.github.io/2019/06/omicidx-on-bigquery/ OmicIDX on BigQuery]
* [http://hgdownload.cse.ucsc.edu/goldenPath/hg19/chromosomes/ hg19] from UCSC (chromosome-wise).


== Which human reference genome to use? ==
== Tutorials ==
http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use (11/13/2017)
See the [[#BWA|BWA]] section.  


== GENCODE transcript database ==
== Whole Exome Seq ==
* [https://www.gencodegenes.org/ GENCODE]
* [http://www.1000genomes.org/category/exome 1000genomes]. 1000genomes and tcga are two places to get vcf files too.
* [https://chitka-kalyan.blogspot.com/2014/02/creating-gencode-transcript-database-in.html Create a GENCODE transcript database in R]
* [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4179624/ Review of Current Methods, Applications, and Data Management for the Bioinformatics Analysis of Whole Exome Sequencing] (Bao 2014)
* [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3083463/ A framework for variation discovery and genotyping using next-generation DNA sequencing data]. See the table 1 there.
* Some data from SRA repository.  
** http://sra.dnanexus.com/?q=cancer+exome&result_type=Study
** http://www.ncbi.nlm.nih.gov/sra/?term=WXS
** [http://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP008740 SRP008740] See [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3956068/ A survey of tools for variant analysis of next-generation sequencing data] (Pabinger 2014)


== [https://en.wikipedia.org/wiki/RefSeq#RefSeq_categories RefSeq categories] ==
== Whole Genome Seq ==
See Table 1 of [https://www.ncbi.nlm.nih.gov/books/NBK21091/ Chapter 18The Reference Sequence (RefSeq) Database].
* [https://www.ncbi.nlm.nih.gov/bioproject/browse/ BioProject] and
** Search: filter by 'Homo sapiens wgs'
** Project data type: Genome sequencing
** Click 'Date' to sort by it
** 20 hits as of 1/11/2017 (many of them do not have data)
* [https://www.ncbi.nlm.nih.gov/bioproject/PRJNA352450 PRJNA352450] 18 experiments
** [https://www.ncbi.nlm.nih.gov/sra/SRX2341045 SRX2341045] 20.5M spots, 4.1G bases, 1.8Gb
* [https://www.ncbi.nlm.nih.gov/bioproject/PRJNA343545 PRJNA343545] 48 experiments
** [https://www.ncbi.nlm.nih.gov/sra/SRX2187657 SRX2187657] 417.4M spots, 126.1G bases, 55.1Gb
* [https://www.ncbi.nlm.nih.gov/bioproject/309109 309109] 5 experiments
** [https://www.ncbi.nlm.nih.gov/sra/SRX1538498 SRX1538498] 1.7M spots, 346.1M bases, 99.7Mb
* [https://www.ncbi.nlm.nih.gov/bioproject/PRJNA289286 PRJNA289286] 5 experiments
** [https://www.ncbi.nlm.nih.gov/sra/SRX1100298 SRX1100298] 504M spots, 101.8G bases, 45.3Gb
* [https://www.ncbi.nlm.nih.gov/bioproject/PRJNA260389 PRJNA260389] 27 experiments
** [https://www.ncbi.nlm.nih.gov/sra/SRX699196 SRX699196] 34,099,675 spots, 6.8G bases, 4.3Gb size
* [https://www.ncbi.nlm.nih.gov/bioproject/248553 248553] 3 experiments
** [https://www.ncbi.nlm.nih.gov/sra/SRX1026041 SRX1026041] 1.2G spots, 250.9G bases, 114.2Gb
* [https://www.ncbi.nlm.nih.gov/bioproject/210123 210123] 26 experiments
** [https://www.ncbi.nlm.nih.gov/sra/SRX318496 SRX318496] 173.7M spots, 34.7G bases, 23Gb
* [https://www.ncbi.nlm.nih.gov/bioproject/43433 43433] 3 experiments (ABI SOLiD System 3.0)
** [https://www.ncbi.nlm.nih.gov/sra/SRX017230 SRX017230] 851.1M spots, 85.1G bases, 68.8Gb


{| class="wikitable centered" style="text-align:center"
== SraRunTable.txt ==
|+
# http://www.ncbi.nlm.nih.gov/sra/?term=SRA059511
|- class="hintergrundfarbe6"
# http://www.ncbi.nlm.nih.gov/sra/SRX194938[accn] and click ''SRP004077''
! Category
# http://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP004077 and click '''Runs''' from the RHS
! Description
# http://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP004077 and click '''RunInfoTable'''
|-
 
| NC
Note that (For this study, it has 2377 rows)
| Complete genomic molecules
* Column A (AssemblyName_s) eg GRCh37
|-
* Column I (library_name_s) eg
| NG
* column N (header=Run_s) shows all SRR or ERR accession numbers.
| Incomplete genomic region
* Column P (Sample_Name)
|-  
* Column Y (header=Assay_Type_s) shows '''WGS'''.
| NM
* Column AB (LibraryLayout_s): PAIRED
| [https://en.wikipedia.org/wiki/MRNA mRNA]
 
|-  
== Predicting gene expression from DNA sequence ==
| NR
[https://www.rna-seqblog.com/predicting-gene-expression-from-dna-sequence-using-deep-learning-models/ Predicting gene expression from DNA sequence using deep learning models]
| [https://en.wikipedia.org/wiki/Non-coding_RNA ncRNA]
 
|-
= Public Data =
| NP
[https://twitter.com/tangming2005/status/1666437518907133954 Ten Resources for easy access public genomic data] 6/7/2023. UCSCXenaTools (TCGA, ICGC, GDC), PharmacoGx, rDGidb, [https://www.omicsdi.org/#/ OmicsDI], AnnotationHub, TCGAbiolinks, GenomicDataCommons, cbioportal.
| [https://en.wikipedia.org/wiki/Protein Protein]
 
|-
[https://waldronlab.io/PublicDataResources/ Public data resources and Bioconductor] from [https://bioc2020.bioconductor.org/workshops.html Bioc2020].
| XM
 
| predicted [[mRNA]] model
{| class="wikitable"
|-
|-
| XR
! Package name
| predicted [[ncRNA]] model
! Object class
|-
! Downloads (Distinct IPs, Jul 2020)
| XP
|-
| predicted [[Protein]] model (eukaryotic sequences)
| [https://www.bioconductor.org/packages/release/bioc/html/GEOquery.html GEOquery]
|-
| SummarizedExperiment
| WP
| 5754
| predicted [[Protein]] model (prokaryotic sequences)
|-
|}
| [https://www.bioconductor.org/packages/release/bioc/html/GenomicDataCommons.html GenomicDataCommons]
 
| GDCQuery
== UCSC version & NCBI release corresponding ==
| 1154
* http://genome.ucsc.edu/FAQ/FAQreleases.html
|-
| [https://www.bioconductor.org/packages/release/bioc/html/TCGAbiolinks.html TCGAbiolinks]<br />[https://www.bioconductor.org/packages/release/data/experiment/html/curatedTCGAData.html curatedTCGAData]
| RangedSummarizedExperiment<br />MultiAssayExperimentObjects
| 2752 <br />275
|-
| [http://www.bioconductor.org/packages/release/bioc/html/recount.html recount]
| RangedSummarizedExperiment
| 418
|-
| [https://www.bioconductor.org/packages/release/data/experiment/html/curatedMetagenomicData.html curatedMetagenomicData]
| ExperimentHub
| 224
|}
 
== Caution ==
[https://www.biorxiv.org/content/10.1101/2024.10.11.617967v2?s=09 Public RNA-seq data are not representative of global human diversity] 2024


== Gene Annotation ==
== ISB Cancer Genomics Cloud (ISB-CGC) ==
* [http://www.genecards.org/ GeneCards]
https://isb-cgc.appspot.com/ Leveraging Google Cloud Platform for TCGA Analysis
* [http://ghr.nlm.nih.gov/GenesBySymbol Genetics Home Reference] from National Library of Medicine
* [http://www.mycancergenome.org/ My Cancer Genome]
* [http://cancer.sanger.ac.uk/cosmic Cosmic]
* [http://www.gettinggeneticsdone.com/2015/11/annotables-convert-gene-ids.html annotables] R package.
* [https://academic.oup.com/bioinformatics/advance-article/doi/10.1093/bioinformatics/btz031/5301311?rss=1 ensembldb] R package
* For gene symbols, there are NCBI and HUGO. See an example from GSE6532 (annot.tam object).


== How many [https://en.wikipedia.org/wiki/DNA DNA] strands are there in humans? ==
The ISB Cancer Genomics Cloud (ISB-CGC) is democratizing access to NCI Cancer Data (TCGA, TARGET, CCLE) and coupling it with unprecedented computational power to allow researchers to explore and analyze this vast data-space.
* http://www.numberof.net/number-of-dna-strands/
* http://www.answers.com/Q/How_many_DNA_strands_are_there_in_humans


== How many base pairs in human ==
[https://github.com/isb-cgc/ISB-CGC-Webapp ISB-CGC Web Application]
* 3 billion base pairs. https://en.wikipedia.org/wiki/Human_genome
* chromosome 22 has the smallest number of bps (~50 million).
* chromosome 1 has the largest number of bps (245 million base pairs).
* Illumina iGenome '''Homo_sapiens/UCSC/hg19/Sequence/WholeGenomeFasta/genome.fa''' file is 3.0GB (so is other genome.fa from human).


== Gene, Transcript, Coding/Non-coding exon ==
== CCLE, DepMap ==
* https://hslnews.wordpress.com/2015/07/02/bioinformatics-bite-how-to-find-the-transcription-start-site-of-a-gene/
* [https://www.nature.com/articles/s41586-019-1186-3 Next-generation characterization of the Cancer Cell Line Encyclopedia] 2019
* According to https://en.wikipedia.org/wiki/Exon, in the human genome only
* It has 1000+ cell lines profiled with different -omics including DNA methylation, RNA splicing, as well as some proteomics (and lots more!).
** 1.1% of the genome is spanned by exons,  
* [https://bioinformatics.mdanderson.org/Supplements/ResidualDisease/Reports/assembleCCLEClinical.html Assembling Clinical Information for the CCLE Data]
** 24% is in introns,  
* Data download [https://depmap.org/portal/download/all/ Depmap]
** 75% of the genome being intergenic DNA.
* [https://depmap.org/portal/ Dependency Map (DepMap)] portal is to empower the research community to make discoveries related to cancer vulnerabilities by providing open access to key cancer dependencies analytical and visualization tools [https://depmap.org/portal/ccle/ CCLE]
* https://twitter.com/ensembl/status/1276469013707665410?s=20
** '''sample_info.csv''' also available from the download page
** '''CCLE_RNAseq_reads.csv''': read counts from RSEM. 1406 x (54358 - 1). Use '''readr::read_csv()'''. range(x[, -1]) = 0 13018000. Note: log2(13018000) = 23.634.
** '''CCLE_expression_full.csv''': log2(TPM + 1). 1406 x (53971 - 1). range(x[, -1]) = 0.00000 17.78354
** '''CCLE_expression.csv''': log2(TPM+1). 1406 x 19221 genes. protein coding genes. 33 diseases.
** '''CCLE_expression_proteincoding_genes_expected_count.csv''': 1406 x (19222 - 1). read count (non-integers) data from RSEM for just protein coding genes. range(x[, -1]) = 0 13018000.
** '''CCLE_expression_transcripts_expected_count.csv''': read count data from RSEM. 1406 x (228138-1). Non-integers. range(x[, -1]) = 0 11664000.
<ul>
<li>[https://bioconductor.org/packages/release/data/experiment/html/depmap.html depmap] package: Cancer Dependency Map Data Package. The depmap package currently contains eight (kinds) datasets available through [http://www.bioconductor.org/packages/release/bioc/html/ExperimentHub.html ExperimentHub].
* RNA inference knockout data
* CRISPR-Cas9 knockout data
* WES copy number data
* CCLE Reverse Phase Protein Array data
* CCLE RNAseq gene expression data
* Cancer cell lines
* Mutation calls
* Drug Sensitivity
<pre>
R> eh <- ExperimentHub()
R> class(eh)
[1] "ExperimentHub"
attr(,"package")
[1] "ExperimentHub"


== SNP ==
R> rnai <- eh[["EH2260"]]
[https://en.wikipedia.org/wiki/Single-nucleotide_polymorphism Types of SNPs and number of SNPs in each chromosomes]
R> class(rnai)
[1] "tbl_df"    "tbl"        "data.frame"
</pre>
</li>
</ul>


== NGS technology ==
== NCI's Genomic Data Commons (GDC)/TCGA ==
* [https://en.wikipedia.org/wiki/Illumina_(company) Illumina - Solexa]
The GDC supports several cancer genome programs at the NCI Center for Cancer Genomics (CCG), including The Cancer Genome Atlas (TCGA), Therapeutically Applicable Research to Generate Effective Treatments (TARGET), and the Cancer Genome Characterization Initiative (CGCI).
* [https://en.wikipedia.org/wiki/ABI_Solid_Sequencing ABI - SOLiD]
* [https://en.wikipedia.org/wiki/454_Life_Sciences Roche 454]


== DNA methylation ==
* [https://portal.gdc.cancer.gov/ NCI's GDC] - Genomic Data Commons Data Portal. Researchers can access over 3 PB of bigData from projects like CPTAC, TARGET and of course TCGA.
* [https://en.wikipedia.org/wiki/GC-content GC content] = (G+C)/(A+T+G+C) x 100%
** [https://gdc.cancer.gov/support/gdc-webinars GDC webinars]
* How many CpGs (C follows by G)?
** [https://gdc.cancer.gov/resources-tcga-users/tcga-code-tables/tcga-study-abbreviations Study Abbreviations]
* [http://genomicsclass.github.io/book/pages/methylation.html Analyzing DNA methylation data] (part of the book [http://genomicsclass.github.io/book/ Biomedical Data Science]) and the [https://www.class-central.com/mooc/1615/edx-ph525x-data-analysis-for-genomics PH525x: Data Analysis for Genomics] (edX course). The Github website is on https://github.com/genomicsclass/labs. The source code may not be correct. See also http://www.biostat.jhsph.edu/~iruczins/teaching/kogo/html/ml/week8/methylation.Rmd. The paper [http://ije.oxfordjournals.org/content/41/1/200.long Bump hunting to identify differentially methylated regions in epigenetic epidemiology studies] the tutorial has mentioned.
* [https://tcpaportal.org/tcpa/download.html MDAnderson] download, [https://tcpaportal.org/tcpa/faq.html FAQ], [https://bioinformatics.mdanderson.org/public-software/tcpa/ Available Software]
<source lang="rsplus">
* [https://bioconductor.org/packages/release/bioc/vignettes/TCGAbiolinks/inst/doc/tcgaBiolinks.html#tcgaanalyze_dea__tcgaanalyze_leveltab:_differential_expression_analysis_(dea) Working with TCGAbiolinks package]
devtools::install_github("coloncancermeth","genomicsclass")
** edgeR is used to find DE; see the TCGAanalyze_DEA() function and [https://www.bioconductor.org/packages/release/bioc/vignettes/TCGAbiolinks/inst/doc/analysis.html#TCGAanalyze_DEA__TCGAanalyze_LevelTab:_Differential_expression_analysis_(DEA) TCGAanalyze: Analyze data from TCGA]
library(coloncancermeth) # 485512 x 26
* [https://bioconductor.org/packages/release/data/experiment/html/GSE62944.html GEO accession data GSE62944 as a SummarizedExperiment] and [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE62944 GEO] website.
data(coloncancermeth) # load meth (methylation data), pd (sample info ) and gr objects
* [https://www.ncbi.nlm.nih.gov/pubmed/25819073 BioXpress: an integrated RNA-seq-derived gene expression database for pan-cancer analysis.]
dim(meth)
* https://github.com/srp33/TCGA_RNASeq_Clinical
dim(pd)
* [https://www.biorxiv.org/content/early/2018/12/21/046904 MOGSA: integrative single sample gene-set analysis of multiple omics data] 2019. The data was obtained from TCGA and NCI60.
length(gr)
* [https://cancerres.aacrjournals.org/content/79/13/3514 RNA Sequencing of the NCI-60: Integration into CellMiner and CellMiner CDB]
colnames(pd)
* [https://www.tandfonline.com/doi/abs/10.1080/01621459.2020.1730853?journalCode=uasa20 Integrating Multidimensional Data for Clustering Analysis With Applications to Cancer Patient Data] 2020
table(pd$Status) # 9 normals, 17 cancers
 
normalIndex <- which(pd$Status=="normal")
=== GenomicDataCommons package ===
cancerlIndex <- which(pd$Status=="cancer")
* [[#GenomicDataCommons_package|See here]]
* [https://seandavi.github.io/post/2017/12/genomicdatacommons-example-uuid-to-tcga-and-target-barcode-translation/ GenomicDataCommons] Example: UUID to TCGA and TARGET Barcode Translation


i=normalIndex[1]
=== NCI60 ===
plot(density(meth[,i],from=0,to=1),main="",ylim=c(0,3),type="n")
[https://dtp.cancer.gov/discovery_development/nci-60/characterization.htm Molecular Characterization of the NCI-60]. NCI-ADR-RES and OVCAR-8 being derived from one another, SNB-19 and U251 are derived from the same patient
for(i in normalIndex){
  lines(density(meth[,i],from=0,to=1),col=1)
}
### Add the cancer samples
for(i in cancerlIndex){
  lines(density(meth[,i],from=0,to=1),col=2)
}


# finding regions of the genome that are different between cancer and normal samples
=== Case studies ===
library(limma)
[https://link.springer.com/content/pdf/10.1186/s40249-020-00662-x.pdf Expression of the SARS-CoV-2 cell receptor gene ACE2 in a wide variety of human tissues]
X<-model.matrix(~pd$Status)
fit<-lmFit(meth,X)
eb <- ebayes(fit)


# plot of the region surrounding the top hit
== NCI Proteomic Data Commons ==
library(GenomicRanges)
https://pdc.cancer.gov/pdc/ vs https://gdc.cancer.gov/
i <- which.min(eb$p.value[,2])
middle <- gr[i,]
Index<-gr%over%(middle+10000)
cols=ifelse(pd$Status=="normal",1,2)
chr=as.factor(seqnames(gr))
pos=start(gr)


plot(pos[Index],fit$coef[Index,2],type="b",xlab="genomic location",ylab="difference")
== GTEx ==
matplot(pos[Index],meth[Index,],col=cols,xlab="genomic location")
* [https://www.gtexportal.org/home/ Genotype-Tissue Expression (GTEx) project]  
# http://www.ncbi.nlm.nih.gov/pubmed/22422453
* [https://master.bioconductor.org/packages/release/workflows/html/recountWorkflow.html recount workflow: accessing over 70,000 human RNA-seq samples with Bioconductor]
* [https://www.biorxiv.org/content/10.1101/602367v1 Basal Contamination of Bulk Sequencing: Lessons from the GTEx dataset]
* [https://bioconductor.org/packages/release/bioc/html/variancePartition.html variancePartition] Quantify and interpret divers of variation in multilevel gene expression experiments. [https://www.biologicalpsychiatryjournal.com/article/S0006-3223(20)31674-7/fulltext Transcriptomic Insight Into the Polygenic Mechanisms Underlying Psychiatric Disorders] 2020


# within each chromosome we usually have big gaps creating subgroups of regions to be analyzed
== NIH LINCS ==
chr1Index <- which(chr=="chr1")
* http://www.lincsproject.org/, http://www.lincsproject.org/LINCS/tools
hist(log10(diff(pos[chr1Index])),main="",xlab="log 10 method")
* [https://bioconductor.org/packages/release/bioc/vignettes/slinky/inst/doc/LINCS-analysis.html slinky], [https://academic.oup.com/bioinformatics/article/35/17/3176/5284904 paper]
* [https://bioconductor.org/packages/release/bioc/html/cmapR.html cmapR]
* [https://pubmed.ncbi.nlm.nih.gov/29065900/ GRcalculator: an online tool for calculating and mining dose-response data]
* [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6381817/ Reproducible Bioconductor workflows using browser-based interactive notebooks and containers]


library(bumphunter)
== Sharing data ==
cl=clusterMaker(chr,pos,maxGap=500)
* [https://datascience.cancer.gov/data-sharing NCI Data Sharing]
table(table(cl)) ##shows the number of regions with 1,2,3, ... points in them
* [https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1006472 Ten quick tips for sharing open genomic data] Brown et al, PLOS 2018
#consider two example regions#
...
</source>


== Whole Genome Sequencing, Whole Exome Sequencing, Transcriptome (RNA) Sequencing ==
= Gene set analysis =
* http://www.rna-seqblog.com/exome-sequencing-vs-rna-seq-to-identify-coding-region-variants/
* [https://www.biostars.org/p/88926/ Over Representation Vs Enrichment Analysis]
* http://www.rna-seqblog.com/combined-use-of-exome-and-transcriptome-sequencing/
* [http://www.genomebiology.com/2010/11/5/R57 A comparison of whole genome and whole transcriptome sequencing]


== Sequence + Expression ==
== Hypergeometric test ==
* [http://www.ncbi.nlm.nih.gov/pubmed/26177635 Integrated sequence and expression analysis of ovarian cancer structural variants underscores the importance of gene fusion regulation]
* [http://mygoblet.org/training-portal/courses/pathway-and-network-analysis-omics-data-2014 A course from bioinformatics.ca] and [http://mygoblet.org/sites/default/files/materrials/Pathways_2014_Module2.pdf over-represented pathway].
* [http://blog.nextgenetics.net/?e=94 How informative are enrichment analyses really?]


== Integrate RNA-Seq and DNA-Seq ==
== Next-generation sequencing data ==
* [https://www.jci.org/articles/view/96153 Integrated RNA and DNA sequencing reveals early drivers of metastatic breast cancer] by Perou. An R code is provided.
* [http://bioinformatics.oxfordjournals.org/content/32/17/i611.full Gene-set association tests for next-generation sequencing data]


== Integrate/combine Omics ==
= Forums =
* [https://github.com/mikelove/awesome-multi-omics?s=09 awesome-multi-omics] by Michael Love
* Biostars source code https://github.com/ialbert/biostar-central
* [https://cran.r-project.org/web/packages/OmicsPLS/index.html OmicsPLS] & [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2371-3 the paper] in BMC Bioinformatics 2018
* https://support.bioconductor.org/ (powered by Biostar too)
* [https://bioconductor.org/packages/release/bioc/html/MultiAssayExperiment.html MultiAssayExperiment] & [http://cancerres.aacrjournals.org/content/77/21/e39 the paper] in AACR 2017
** [https://waldronlab.io/MultiAssayWorkshop/ Multi-omic Integration and Analysis of cBioPortal and TCGA data with MultiAssayExperiment] from [https://bioc2020.bioconductor.org/workshops.html Bioc2020]
* [https://cran.r-project.org/web/packages/mixOmics/index.html mixOmics], http://mixomics.org/, [https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1005752 the paper] on PLOS 2017
* [https://academic.oup.com/biostatistics/advance-article/doi/10.1093/biostatistics/kxy044/5092386 The impact of different sources of heterogeneity on loss of accuracy from genomic prediction models] Biostatistics 2018


== Gene expression ==
= Batch effect =
Expression level is the amount of RNA in cell that was transcribed from that gene. [https://speakerdeck.com/alyssafrazee/high-resolution-gene-expression-analysis Slides] from Alyssa Frazee.
[[Batch_effect|Batch effect]]


== Quantile normalization ==
= Misc =
* https://en.wikipedia.org/wiki/Quantile_normalization
== Advice ==
* [https://www.biostars.org/p/286278/ Question: Quantile normalizing prior to or after TPM scaling?]
* [https://widdowquinn.github.io/ten_great_papers/ Ten great papers for biologists starting out in computational biology]
* [https://www.biorxiv.org/content/biorxiv/early/2014/12/04/012203.full.pdf When to use Quantile Normalization?] and its R package [http://www.bioconductor.org/packages/release/bioc/html/quantro.html quantro]
* [https://github.com/nih-byob/presentations/tree/master/2019/01_bioinformatics_tips Bioinformatics advice I wish I learned 10 years ago] from NIH
* normalize.quantiles() from preprocessCore package. Note for ties, the average is used in normalize.quantiles(), ((4.666667 + 5.666667) / 2) = 5.166667. <syntaxhighlight lang='rsplus'>
source('http://bioconductor.org/biocLite.R')
biocLite('preprocessCore')
#load package
library(preprocessCore)
#the function expects a matrix
#create a matrix using the same example
mat <- matrix(c(5,2,3,4,4,1,4,2,3,4,6,8),
            ncol=3)
mat
#    [,1] [,2] [,3]
#[1,]    5    4    3
#[2,]    2    1    4
#[3,]    3    4    6
#[4,]    4    2    8
#quantile normalisation
normalize.quantiles(mat)
#        [,1]    [,2]    [,3]
#[1,] 5.666667 5.166667 2.000000
#[2,] 2.000000 2.000000 3.000000
#[3,] 3.000000 5.166667 4.666667
#[4,] 4.666667 3.000000 5.666667
</syntaxhighlight>


== Merging two gene expression studies; batch effect ==
== High Performance ==
* [https://www.coursera.org/lecture/statistical-genomics/module-2-overview-1-12-cbqYZ Statistics for Genomic Data Science] (Coursera) and https://github.com/jtleek/genstats
* https://www.youtube.com/watch?v=M3RVfv6lUtc NYCMC
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2263-6 Alternative empirical Bayes models for adjusting for batch effects in genomic studies] Zhang et al. BMC Bioinformatics 2018. The R package is [http://www.bioconductor.org/packages/release/bioc/html/BatchQC.html BatchQC] from Bioconductor.
* [https://www.rdocumentation.org/packages/sva/versions/3.20.0/topics/ComBat Combat()] function in [http://www.bioconductor.org/packages/release/bioc/html/sva.html sva] package from Bioconductor.
** It can remove both known batch effects and other potential latent sources of variation.
** The tutorial includes information on (1) how to estimate the number of latent sources of variation, (2) how to apply the sva package to estimate latent variables such as batch effects, (3) how to directly remove known batch effects using the ComBat function, (4) how to perform differential expression analysis using surrogate variables either directly or with thelimma package, and (4) how to apply “frozen” sva to improve prediction and clustering.
** [https://bmccancer.biomedcentral.com/track/pdf/10.1186/s12885-018-4546-8#page=4 Figure S1 shows the principal component analysis (PCA) before and after batch effect correction for training and validation datasets]
** [https://www.bioconductor.org/packages/release/bioc/vignettes/sva/inst/doc/sva.pdf#page=7 Tutorial example] to remove the batch effect
:<syntaxhighlight lang='bash'>
library(sva)
library(bladderbatch)
data(bladderdata)
pheno = pData(bladderEset)
edata = exprs(bladderEset)
batch = pheno$batch
modcombat = model.matrix(~1, data=pheno)
combat_edata = ComBat(dat=edata, batch=batch, mod=modcombat,
                      par.prior=TRUE, prior.plots=FALSE)
# This returns an expression matrix, with the same dimensions
# as your original dataset.
# By default, it performs parametric empirical Bayesian adjustments.
# If you would like to use nonparametric empirical Bayesian adjustments,
# use the par.prior=FALSE option (this will take longer).
</syntaxhighlight>
* [https://academic.oup.com/bioinformatics/article/24/9/1154/206630 Merging two gene-expression studies via cross-platform normalization] by Shabalin et al, Bioinformatics 2008. This method (called '''Cross-Platform Normalization/XPN''')was used by Ternès Biometrical Journal 2017.
* [https://academic.oup.com/bib/article/14/4/469/191565 Batch effect removal methods for microarray gene expression data integration: a survey] by Lazar et al, Bioinformatics 2012. The R package is '''[http://bioconductor.org/packages/3.3/bioc/html/inSilicoMerging.html inSilicoMerging]''' which has been removed from Bioconductor 3.4.
* [https://support.bioconductor.org/p/25840/ Question: Combine hgu133a&b and hgu133plus2]. [https://academic.oup.com/biostatistics/article/8/1/118/252073 Adjusting batch effects in microarray expression data using empirical Bayes methods]
* [https://rdrr.io/bioc/limma/man/removeBatchEffect.html removeBatchEffect()] from limma package
* [https://biodatascience.github.io/compbio/dist/batch.html Batch effects and GC content] of NGS by Michael Love


== Fusion gene ==
== Cloud Computing ==
https://en.wikipedia.org/wiki/Fusion_gene
* [https://github.com/VCCRI/Falco/ '''Falco''': A quick and flexible single-cell RNA-seq processing framework on the cloud]
 
* [https://youtu.be/cP5rvWoJDOQ Getting started with Bioconductor in the cloud]
== Structural variation ==
* [https://www.rna-seqblog.com/micloud-a-bioinformatics-cloud-for-seamless-execution-of-complex-ngs-data-analysis-pipelines/ miCloud]: a bioinformatics cloud for seamless execution of complex NGS data analysis pipelines
* https://en.wikipedia.org/wiki/Structural_variation
 
* https://www.ncbi.nlm.nih.gov/dbvar/content/overview/
== Merge different datasets (different genechips) ==
* [https://www.biorxiv.org/content/biorxiv/early/2018/02/01/200170.full.pdf Detection of complex structural variation from paired-end sequencing data] Joseph G. Arthur, 2018
* https://support.bioconductor.org/p/65506/
 
== Genomic data vs transcriptomic data ==
* The main difference between genomic data and transcriptomic data is that genomic data provides information on the complete DNA sequence of an organism, while transcriptomic data provides information on the expression levels of genes.
* Genomic data:
** Genomic data refers to the complete DNA sequence of an organism, which includes all of its genes, regulatory regions, and non-coding regions. This type of data provides information on the genetic makeup of an organism, including its potential to develop certain diseases, its evolutionary history, and its overall genetic diversity.
** Examples of genomic data: Whole genome sequencing (WGS), Genome-wide association studies (GWAS), Copy number variation (CNV) analysis, Comparative genomics, Metagenomics.
* Transcriptomic data
** Transcriptomic data, on the other hand, refers to the collection of all RNA transcripts produced by the genes of an organism. RNA transcripts are produced when genes are transcribed into RNA molecules, which are then used as templates to synthesize proteins. Transcriptomic data provides information on the expression levels of genes, which can help researchers understand how genes are regulated and how they contribute to biological processes.
** Examples of transcriptomic data: RNA-Seq, Microarray, scRNA-Seq, qPCR, Ribosome profiling
 
== Low read count and filtering ==
* DESeq2 '''pre-filtering''':
** ''While it is not necessary to pre-filter low count genes before running the DESeq2 functions, there are two reasons which make pre-filtering useful: by removing rows in which there are very few reads, we reduce the memory size of the dds data object, and we increase the speed of the transformation and testing functions within DESeq2.'' [https://www.bioconductor.org/packages/devel/bioc/vignettes/DESeq2/inst/doc/DESeq2.html#pre-filtering DESeq2 vignette].  
** One can also omit this step entirely and just rely on the '''independent filtering''' procedures available in results(), either IHW or genefilter::filtered_p().
:<syntaxhighlight lang='r'>
smallestGroupSize <- 3 # smallest group size
keep <- rowSums(counts(dds) >= 10) >= smallestGroupSize
dds <- dds[keep, ]
</syntaxhighlight>


[https://github.com/arq5x/lumpy-sv LUMPY], [https://github.com/dellytools/delly DELLY], [https://sites.google.com/site/sebatlab/software-data ForestSV], [http://gmt.genome.wustl.edu/packages/pindel/ Pindel], [http://breakdancer.sourceforge.net/ breakdancer] , [http://svdetect.sourceforge.net/Site/Home.html SVDetect].
* '''glmnet(, exclude)'''. See its [https://cran.r-project.org/web/packages/glmnet/vignettes/glmnet.pdf#page=27 vignettte] for some examples including computing univariate T-test and excluding 40% genes with low T-statistic. Notice the <span style="color: red"> bias</span> could be introduced if we use both x and y to filter variables unless the same procedure is applied during CV.
* [https://combine-australia.github.io/RNAseq-R/slides/RNASeq_filtering_qc.pdf#page=10 RNA-seq: filtering, quality control and visualisation]. As a general rule, a good threshold can be chosen for a '''CPM''' value that corresponds to a count of 10.
* [https://pubmed.ncbi.nlm.nih.gov/26737772/ Effect of low-expression gene filtering on detection of differentially expressed genes in RNA-seq data] 2015
* [https://seqqc.wordpress.com/2020/02/17/removing-low-count-genes-for-rna-seq-downstream-analysis/ Removing low count genes for RNA-seq downstream analysis]  
* [https://bioinformatics-core-shared-training.github.io/cruk-summer-school-2018/RNASeq2018/html/02_Preprocessing_Data.nb.html#filtering-the-genes RNA-seq analysis in R Pre-processsing RNA-seq data]. ''It keeps all genes where the total number of reads across all samples is greater than 5.''
* [http://monashbioinformaticsplatform.github.io/RNAseq-DE-analysis-with-R/RNAseq_DE_analysis_with_R.html RNAseq data analysis in R - Notebook]. ''A common way to do this is by filtering out genes having less than 1 count-per-million reads ('''cpm''') in half the samples. The “edgeR” library provides the '''cpm''' function which can be used here.''
* [https://www.bioconductor.org/help/course-materials/2016/CSAMA/lab-3-rnaseq/rnaseq_gene_CSAMA2016.html#pre-filtering-rows-with-very-small-counts RNA-seq workflow - gene-level exploratory analysis and differential expression]. ''we will remove those genes which have a total count of less than 5.''
* [https://biocorecrg.github.io/RNAseq_course_2019/differential_expression.html  Differential expression analysis] workshop material. It referred to this paper [https://f1000research.com/articles/5-1438/v2 From reads to genes to pathways: differential expression analysis of RNA-Seq experiments using Rsubread and the edgeR quasi-likelihood pipeline]. It uses the criterion ''we keep genes that have '''CPM''' values above 0.5 in at least two libraries''.
* [https://web.stanford.edu/class/bios221/labs/rnaseq/lab_4_rnaseq.html RNA Sequence Analysis in R: edgeR] which also uses '''cpm''' to filter genes.


== RNASeq + ChipSeq ==
=== Independent Filtering ===
* [http://www.nature.com/jhg/journal/vaop/ncurrent/full/jhg201584a.html Elucidating the mechanisms of transcription regulation during heart development by next-generation sequencing]
<ul>
<li>[https://bioconductor.org/packages/release/bioc/html/genefilter.html genefilter] package. [https://bioconductor.org/packages/release/bioc/vignettes/genefilter/inst/doc/independent_filtering_plots.pdf Independent filtering vignette].
* In the 1st plot, the legend represents different threshold values (θ). For instance, when θ = 0.1, we filter out 10% of hypotheses before conducting multiple testing.
* The 1st plot shows the larger the theta, the more number of hypotheses are rejected when we consider a fixed FDR cutoff. But the plot does not consider larger theta values.
* The second plot indicates what is the optimal theta threshold to filter genes.
* In this example, removing 60% genes rejects the most number of hypotheses/returns the most number of discoveries.
* It can be seen very large values of theta could reduce power.
* The '''filter parameter''' in [https://www.rdocumentation.org/packages/genefilter/versions/1.54.2/topics/filtered_p filtered_p() or filtered_R()] represents '''ranks'''. That is, using, for example, S2(=rowVars()) or S3=rank(S2) as the '''filter''' returns the same result.
:<syntaxhighlight lang='r'>
# filtered_p: Returned BH adjusted p for different thresholds defined in theta.
#            This can be used to generate the 1st plot.
filtered_p(filter, test, theta, data, method = "none")
# filtered_R: Returned the number of rejections using the specified BH cutoff (alpha)
#            for different thresholds.
#            This can be used to generate the 2nd & 3rd plots and find the optimal threshold.
filtered_R(alpha, filter, test, theta, data, method = "none")
</syntaxhighlight>
* The last plot uses sample mean instead of sample variance as the filter statistic. As we can see, only 10% genes are filtered out.
</br>
[[File:Filtered_p.png|220px]] [[File:Filtered R.png|220px]] [[File:Filtered R mean.png|220px]]


== Labs ==
<li>DESeq2 [https://www.bioconductor.org/packages/devel/bioc/vignettes/DESeq2/inst/doc/DESeq2.html#indfilt Independent filtering of results]. '''Independent filtering is performed AFTER the differential expression analysis (DEA) in DESeq2.'''
* [http://salzberg-lab.org/courses/ Steven Salzberg]
* The results function of the DESeq2 package performs independent filtering by default using the '''mean of normalized counts''' as a '''filter statistic'''.
* A threshold on the '''filter statistic''' is found which optimizes the number of adjusted p values lower than a significance level alpha.
* The adjusted p values for the genes which do not pass the filter threshold are set to '''NA'''.


== Biowulf2 at NIH ==
<li>[https://youtu.be/Gi0JdrxRq5s StatQuest: edgeR and DESeq2, part 2]. Mitigate the multiple testing problem. [https://statquest.org/statquest-filtering-genes-with-low-read-counts/ code], [https://techal.org/mitigating-the-multiple-testing-problem-independent-filtering-with-edger-and-deseq2 written guide].
* Main site: http://hpc.nih.gov
* A simulated data shows '''[https://youtu.be/Gi0JdrxRq5s?si=1klGB8taFVnZ1B9v&t=462 FDR is doing a great job limiting number of <span style="color: orange">False Positives</span> in the significant results, but it's not awesome keeping the <span style="color: green">True Positives</span>]'''.
* User guide: https://hpc.nih.gov/docs/user_guides.html
* [https://youtu.be/Gi0JdrxRq5s?si=1pJkbX6_ltrAB0Nx&t=542 Each time we increase the number of bogus tests, we reduce the number of True Positive p-values < .05 that survive the FDR adjustment].
* Unlock account (60 days inactive) https://hpc.nih.gov/dashboard/
* [https://youtu.be/Gi0JdrxRq5s?si=OAsr2lI92sf0429P&t=580 A plot of True/False Positives vs Number of bogus tests]. That means FDR is still having its limitation. <s>The independent filtering helps address this limitation.</s>
* Transitioning from PBS to Slurm: https://hpc.nih.gov/docs/pbs2slurm.html
* [https://youtu.be/Gi0JdrxRq5s?si=qDEhvzHcI7_M3eX_&t=637 edgeR recommends removing all genes except those with > 1 CPM in 2 or more samples]. It compensates for differences in read depth between libraries. The CPM cutoff "1" depends on the data. [https://youtu.be/Gi0JdrxRq5s?si=m6YVfwkIBwZGd1dN&t=924 How can we determine what a good CPM cutoff is?].
* Job Submission 'cheat sheet': https://hpc.nih.gov/docs/biowulf2-handout.pdf
* [https://youtu.be/Gi0JdrxRq5s?si=LX2m1mlFVZH9REzY&t=983 Differences of edgeR and DESeq2].  
* STAR: https://hpc.nih.gov/apps/STAR.html
* [https://youtu.be/Gi0JdrxRq5s?si=vZc0m5wdoABAkrQ6&t=1160 Y-axis is number of significant genes, X-axis is the threshold/quantiles]. Choose the threshold/quantile such that the number of significant genes is maximized.
* [https://youtu.be/Gi0JdrxRq5s?si=1cdGVRdEIigXp6IW&t=1267 Advice]. We see the filtering was done after calculating p-values.  


== [https://github.com/DecodeGenetics/BamHash BamHash] ==
<li>[https://bioconductor.org/help/course-materials/2011/CSAMA/Thursday/Morning%20Talks/110629-multtestindepfilt-huber.pdf Sensitivity, Specificity, ROC, Multiple testing, Independent filtering] by Wolfgang Huber.
Hash BAM and FASTQ files to verify data integrity. The C++ code is based on OpenSSL and seqan libraries.
<li>[https://pubmed.ncbi.nlm.nih.gov/20460310/ Independent filtering increases detection power for high-throughput experiments]. Richard Bourgon 2010.
<li>[https://hbctraining.github.io/DGE_workshop_salmon_online/lessons/05b_wald_test_results.html Exploring DESeq2 results: Wald test]. 3. Genes with a low mean normalized counts.
<li>[https://www.r-bloggers.com/2012/09/deseq-vs-edger-comparison/ DESeq vs edgeR Comparison].
</ul>


== Reproducibility ==
=== edgeR::filterByExpr ===
* [https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1007881 Improving reproducibility in computational biology research]
* [https://rdrr.io/bioc/edgeR/man/filterByExpr.html ?filterByExpr]
* [http://www.biorxiv.org/content/early/2017/07/19/165191 SnakeChunks: modular blocks to build Snakemake workflows for reproducible NGS analyses] by Claire Rioualen et al, 2017.
* [https://bioconductor.org/packages/release/bioc/vignettes/limma/inst/doc/usersguide.pdf#page=71 limma] user guide
* [https://support.bioconductor.org/p/9151145/ Is it okay to increase filtering to get more significant Adjusted P Values for DEGs found using Limma?]
* [https://support.bioconductor.org/p/9157095/ DESeq2 filtering vs edgeR filtering]


== Selected Papers ==
== Normalization ==
* [http://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-0961-5 Testing for association between RNA-Seq and high-dimensional data] and the Bioconductor package globalSeq.
* [http://nar.oxfordjournals.org/content/early/2015/07/21/nar.gkv736.long How data analysis affects power, reproducibility and biological insight of RNA-seq studies in complex datasets] 2015
* [http://link.springer.com/article/10.1208%2Fs12248-016-9917-y The FDA’s Experience with Emerging Genomics Technologies—Past, Present, and Future]
* [http://www.biomedcentral.com/1471-2105/16/347 Comparing the normalization methods for the differential analysis of Illumina high-throughput RNA-Seq data] 2015
* [http://www.nature.com/nbt/journal/v31/n1/abs/nbt.2450.html Differential analysis of gene regulation at transcript resolution with RNA-seq] Trapnell et al, Nature Biotechnology 31, 46–53 (2013)
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2382-0 Expression analysis of RNA sequencing data from human neural and glial cell lines depends on technical replication and normalization methods] 2018
* [http://cancerres.aacrjournals.org/content/early/2016/12/01/0008-5472.CAN-16-1624.long A Study of TP53 RNA Splicing Illustrates Pitfalls of RNA-seq Methodology]
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2745-1 A statistical normalization method and differential expression analysis for RNA-seq data between different species] Zhou 2019
* [http://www.rna-seqblog.com/top-rna-seq-articles-2016/ Top RNA-Seq Articles – 2016] from RNA-Seq blog
* [https://github.com/crazyhottommy/RNA-seq-analysis RNA-seq analysis] some notes from Ming Tang
* [http://onlinelibrary.wiley.com/doi/10.1111/biom.12745/full Multivariate association analysis with somatic mutation data] by He 2017 Biometrics.
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-3247-x A protocol to evaluate RNA sequencing normalization methods] Abrams et al 2019. It concluded that transcripts per million ('''TPM''') was the best performing normalization method based on its preservation of biological signal as compared to the other methods tested.
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-3433-x RASflow – An RNA-Seq Analysis Workflow with Snakemake] Zhang 2019
* [https://bioconductor.github.io/BiocWorkshops/rna-seq-analysis-is-easy-as-1-2-3-with-limma-glimma-and-edger.html#data-pre-processing Data pre-processing] 6.6.3 Normalising gene expression distributions. log2 CPM (counts per million) was considered. edgeR::calcNormFactors(x, method = "TMM") was used to normalize counts.
* [http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0157989 A Survey of Bioinformatics Database and Software Usage through Mining the Literature]
* [https://morphoscape.wordpress.com/2020/09/26/generalized-linear-models-and-plots-with-edger-advanced-differential-expression-analysis/ Generalized Linear Models and Plots with edgeR – Advanced Differential Expression Analysis]
* [https://www.nature.com/articles/srep18898 CrossNorm: a novel normalization strategy for microarray data in cancers] Cheng 2016
* [https://rdrr.io/bioc/EnrichmentBrowser/man/normalize.html EnrichmentBrowser::normalize()]
* [http://www.bioconductor.org/packages/release/bioc/vignettes/SingleCellExperiment/inst/doc/intro.html SingleCellExperiment] vignette. It lists 4 special assays: counts, logcounts, '''cpm''' and '''tpm'''.
* [https://compgenomr.github.io/book/gene-expression-analysis-using-high-throughput-sequencing-technologies.html#within-sample-normalization-of-the-read-counts 8.3.4 Within sample normalization of the read counts] and [https://compgenomr.github.io/book/gene-expression-analysis-using-high-throughput-sequencing-technologies.html#computing-different-normalization-schemes-in-r 8.3.5 Computing different normalization schemes in R] from Computational Genomics with R by Altuna Akalin
** '''CPM''' is the simplest method. It addresses the '''sequencing depth''' bias by normalizing the read counts per gene by dividing each gene’s read count by a certain value and multiplying it by 10^6. There are 3 ways for the denominator: Total Counts Normalization, Upper Quartile Normalization and Median Normalization.
** Popular metrics that improve upon CPM are RPKM/FPKM (reads/fragments per kilobase of million reads) and TPM (transcripts per million).
** '''RPKM''' is obtained by dividing the CPM value by another factor, which is the length of the gene per kilobase. FPKM (substitute ''reads'' with ''fragments'') is the same as RPKM, but is used for paired-end reads. So RPKM differs from CPM by adding one step.
** '''TPM''' also controls for both the library size and the gene lengths, however, with the TPM method, the read counts are first normalized by the gene length (per kilobase), and then gene-length normalized values are divided by the sum of the gene-length normalized values and multiplied by 10^6.
** '''Library composition''' or '''RNA composition'''. In DESeq2 the read counts are normalized by computing size factors, which addresses the differences not only in the library sizes, but also the ''library compositions''. See [https://compgenomr.github.io/book/gene-expression-analysis-using-high-throughput-sequencing-technologies.html#differential-expression-analysis 8.3.7 Differential expression analysis]
*** [https://youtu.be/Wdt6jdi-NQo?t=54 Different samples contain different active genes]
*** [https://chipster.csc.fi/manual/deseq2.html This procedure corrects for library size and RNA composition bias, which can arise for example when only a small number of genes are very highly expressed in one experiment condition but not in the other].
*** [https://hbctraining.github.io/DGE_workshop_salmon/lessons/01_DGE_setup_and_overview.html DESeq2 first normalizes the count data to account for differences in library sizes and RNA composition between samples].
*** A few ''highly'' differentially expressed genes between samples, differences in the number of genes expressed between samples, or presence of contamination can skew some types of normalization methods. [https://hbctraining.github.io/DGE_workshop_salmon/lessons/02_DGE_count_normalization.html Introduction to DGE] gives a nice graphical illustration of RNA composition.
*** [https://youtu.be/UFB993xufUU?t=215 StatQuest: DESeq2, part 1, Library Normalization] - adjusting for differences in library composition
*** '''Sequencing bias detection''' from [https://www.bioconductor.org/packages/release/bioc/vignettes/NOISeq/inst/doc/NOISeq.pdf#page=12 RNA composition] from the NOISeq's vignette.
* [https://academic.oup.com/bib/article/19/5/776/3056951#supplementary-data Selecting between-sample RNA-Seq normalization methods from the perspective of their assumptions] Evans 2018. R code is in github. [http://www.bioconductor.org/packages/release/data/experiment/html/seqc.html seqc] package from Bioconductor.
* [https://www.biorxiv.org/content/10.1101/2021.03.11.435043v2 Evaluation of critical data processing steps for reliable prediction of gene co-expression from large collections of RNA-seq data] Vandenbon 2021. Methods that correct for differences in gene length (RPKM and FPKM) don't affect correlation value; that is, these methods would be equivalent to '''CPM''' normalization.
* [https://translational-medicine.biomedcentral.com/articles/10.1186/s12967-021-02936-w TPM, FPKM, or Normalized Counts? A Comparative Study of Quantification Measures for the Analysis of RNA-seq Data from the NCI Patient-Derived Models Repository] Zhao 2021
* Youtube
** [https://youtu.be/UFB993xufUU StatQuest: DESeq2, part 1, Library Normalization], [http://bioconductor.org/books/release/OSCA/data-infrastructure.html scran::computeSumFactors()]
** [https://youtu.be/Wdt6jdi-NQo StatQuest: edgeR, part 1, Library Normalization] (TMM)
** [https://youtu.be/TTUrtCY2k-w RPKM, FPKM and TPM, Clearly Explained!!!]
** [https://www.youtube.com/watch?v=tlf6wYJrwKY&list=PLblh5JKOoLUJo2Q6xK4tZElbIvAACEykp High Throughput Sequencing]
* [https://www.rna-seqblog.com/robust-normalization-and-transformation-techniques-for-constructing-gene-coexpression-networks-from-rna-seq-data/ Robust normalization and transformation techniques for constructing gene coexpression networks from RNA-seq data] 2022


== Pictures ==
=== log2 transformation ===
https://www.flickr.com/photos/genomegov
No matter we use TPM, TMM, FPKM, or DESeq2 normalized counts, we still need to take a log2(x+1) transformation before any analyses.


== 用DNA做身分鑑識 ==
=== Quantile normalization ===
[https://www.worldjournal.com/5120826/article-《社會傳真》用dna做身分鑑識/ 用DNA做身分鑑識]
* https://en.wikipedia.org/wiki/Quantile_normalization. The new values are the '''averaged''' '''ordered''' values per gene based on the original rank.
* [https://www.r-bloggers.com/2024/03/mastering-quantile-normalization-in-r-a-step-by-step-guide/ Mastering Quantile Normalization in R: A Step-by-Step Guide]. The quantiles of the normalized data are consistent across the different datasets.
* [https://www.biostars.org/p/286278/ Question: Quantile normalizing prior to or after TPM scaling?]
* [https://www.biorxiv.org/content/biorxiv/early/2014/12/04/012203.full.pdf When to use Quantile Normalization?] and its R package [http://www.bioconductor.org/packages/release/bioc/html/quantro.html quantro]
* [https://davetang.org/muse/2014/07/07/quantile-normalisation-in-r/ Quantile normalisation in R]
<ul>
<li>normalize.quantiles() from preprocessCore package. [https://www.statology.org/quantile-normalization-in-r/ How to Perform Quantile Normalization in R]
* for ties, the average is used in normalize.quantiles(), ((4.666667 + 5.666667) / 2) = 5.166667.
* I got into an error when I use the function in RStudio docker container but the solution [https://support.bioconductor.org/p/122925/#9135989 here] ('''BiocManager::install("preprocessCore", configure.args="--disable-threading")''') works.
<syntaxhighlight lang='rsplus'>
source('http://bioconductor.org/biocLite.R')
biocLite('preprocessCore')
#load package
library(preprocessCore)
#the function expects a matrix
#create a matrix using the same example
mat <- matrix(c(5,2,3,4,4,1,4,2,3,4,6,8),
            ncol=3)
mat
#    [,1] [,2] [,3]
#[1,]    5    4    3
#[2,]    2    1    4
#[3,]    3    4    6
#[4,]    4    2    8
#quantile normalisation
normalize.quantiles(mat)
#        [,1]    [,2]    [,3]
#[1,] 5.666667 5.166667 2.000000
#[2,] 2.000000 2.000000 3.000000
#[3,] 3.000000 5.166667 4.666667
#[4,] 4.666667 3.000000 5.666667
</syntaxhighlight>
</li>
</ul>


== 如何自学入门生物信息学 ==
=== Distribution, density plot ===
https://zhuanlan.zhihu.com/p/32065916
[https://www.researchgate.net/figure/Density-plot-showing-the-distribution-of-RNA-seq-read-counts-FPKM-of-PEG-treated_fig2_318575379 Density plot showing the distribution of RNA-seq read counts (FPKM)] log10(FPKM)


== Staying current ==
=== Negative binomial distribution ===
[http://www.gettinggeneticsdone.com/2017/02/staying-current-in-bioinformatics-genomics-2017.html Staying Current in Bioinformatics & Genomics: 2017 Edition]
[https://support.bioconductor.org/p/74572/ RNA-seq and Negative binomial distribution]


== Papers ==
== Z-score transformation ==
* [http://www.nature.com/nature/journal/vaop/ncurrent/full/nature24286.html DNA sequencing at 40: past, present and future]
* This practice has been used extensively in papers without a clear foundation.
* [https://www.jmdjournal.org/article/S1525-1578(10)60455-2/fulltext Analysis of Microarray Data Using Z Score Transformation] Cheadle 2003. Z-normalization was calculated '''per gene'''.
** For example, [https://www.nature.com/articles/s41598-020-66986-8 ssGSEA score-based Ras dependency indexes derived from gene expression data reveal potential Ras addiction mechanisms with possible clinica implications] applies z-scores on each gene AND ssGSEA scores for each pathway/gene signature.
* [https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0085150 Transforming RNA-Seq Data to Improve the Performance of Prognostic Gene Signatures] Zwiener 2014. Often, standardizing gene expressions is implemented as a default in software packages.
* [https://bioinformatics.stackexchange.com/a/2181 RNAseq: Z score, Intensity, and Resources]. ''For visualization in heatmaps or for other clustering (e.g., k-means, fuzzy) it is useful to use z-scores.''


== Common issues in algorithmic bioinformatics papers ==
== Ensembl to gene symbol ==
[http://medvedevgroup.com/2019/08/11/what-are-some-common-issues-i-find-when-reviewing-algorithmic-bioinformatics-conference-papers/ What are some common issues I find when reviewing algorithmic bioinformatics conference papers?]
* http://useast.ensembl.org/index.html (seems down). [http://training.ensembl.org/exercises Training].
* Online tools
** [https://www.syngoportal.org/convert SynGO - ID conversion tool]
** [https://www.biotools.fr/human/ensembl_symbol_converter ENSEMBL Gene ID to Gene Symbol Converter]
** https://biit.cs.ut.ee/gprofiler/convert and [https://www.rdocumentation.org/packages/gprofiler2/versions/0.2.3/topics/gconvert gprofile2::gconvert] function
* R. [https://medium.com/computational-biology/gene-id-mapping-using-r-14ff50eec9ba Gene ID mapping using R].
** [https://www.rdocumentation.org/packages/AnnotationDbi/versions/1.34.4/topics/AnnotationDb-objects AnnotationDbi::mapIds()] function + [https://www.biostars.org/p/239681/ "org.Hs.eg.db"] package. It works well.
*** Vignette of [https://www.bioconductor.org/packages/release/bioc/html/EnhancedVolcano.html EnhancedVolcano] package
*** [https://www.r-bloggers.com/2016/07/converting-gene-names-in-r-with-annotationdbi/ Converting Gene Names in R with AnnotationDbi]
*** my [https://gist.github.com/arraytools/6e6142f6fabb31e54e188ea1fb0deeee TCGAbiolinks-GBM.Rmd].
** getBM() from [https://stackoverflow.com/a/58875340 "biomaRt"] package
** [https://rdrr.io/bioc/tidybulk/man/ensembl_symbol_mapping.html ensembl_to_symbol()] from tidybulk package.
** [https://github.com/stemangiola/bioc_2020_tidytranscriptomics A Tidy Transcriptomics introduction to RNA sequencing analyses] (Bioc 2020).


== Precision Medicine courses ==
== How to use [http://genome.ucsc.edu/cgi-bin/hgTables UCSC Table Browser] ==
* [https://gmi.ucsf.edu/cme-outreach/ UCSF]
* An instruction from [http://bitseq.github.io/howto/index BitSeq] software
* [http://openonlinecourses.com/ehr/PrecisionAndPredictiveMedicine.asp Precision & Predictive Medicine]
* [https://www.biostars.org/p/93011/ How To Get Bed File Containing Exons Of Canonical Transcripts And Their Corresponding Gene Symbols]
* [https://www.biostars.org/p/156637/ Where to download refseq gene coding regions data?]
** http://genome.ucsc.edu/cgi-bin/hgTables OR
** Download '''refGene.txt.gz''' file from UCSC directly using http links
* [https://www.biostars.org/p/94823/ Where To Download Genome Annotation Including Exon, Intron, Utr, Intergenic Information?]


== Personalized medicine ==
[[:File:Tablebrowser.png]] [[:File:Tablebrowser2.png]]
* [https://www.nytimes.com/2017/08/30/health/gene-therapy-cancer.html F.D.A. Approves First Gene-Altering Leukemia Treatment]
* [http://time.com/4989537/blood-cancer-gene-therapy/ The FDA Just Approved a New Way of Fighting (lymphoma) Cancer Using Personalized Gene Therapy]
* [https://ghr.nlm.nih.gov/primer/precisionmedicine/precisionvspersonalized What is the difference between precision medicine and personalized medicine? What about pharmacogenomics?] "personalized medicine" is an older term. [https://ghr.nlm.nih.gov/primer Help Me Understand Genetics]


== Cancer and gene markers ==
Note
* '''Colorectal cancer''' patients without '''KRAS mutations''' have far better outcomes with '''EGFR treatment''' than those with KRAS mutations.  
# the UCSC browser will return the output on browser by default. Users need to use the browser to save the file with self-chosen file name.
** Two '''EGFR inhibitors''', cetuximab and panitumumab are not recommended for the treatment of colorectal cancer in patients with KRAS mutations in codon 12 and 13.
# the output does not have a header
* '''Breast cancer'''. 
# The bed format is explained in https://genome.ucsc.edu/FAQ/FAQformat.html#format1
** [https://en.wikipedia.org/wiki/Trastuzumab Trastuzumab]
** [https://en.wikipedia.org/wiki/Tamoxifen Tamoxifen]


== The shocking truth about space travel ==
If I select "Whole Genome", I will get a file with 75,893 rows. If I choose "Coding Exons", I will get a file with 577,387 rows.
[https://www.morningticker.com/2018/03/the-shocking-truth-about-space-travel/ 7 percent of DNA belonging to NASA astronaut Scott Kelly changed in the time he was aboard the International Space Station]
<pre style="white-space: pre-wrap; /* CSS 3 */ white-space: -moz-pre-wrap; /* Mozilla, since 1999 */ white-space: -pre-wrap; /* Opera 4-6 */ white-space: -o-pre-wrap; /* Opera 7 */ word-wrap: break-word; /* IE 5.5+ */ " >
 
$ wc -l hg38Tables.bed
== bioSyntax: syntax highlighting for computational biology ==
75893 hg38Tables.bed
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2315-y
$ head -2 hg38Tables.bed
chr1 67092175 67134971 NM_001276352 0 - 67093579 67127240 0 9 1429,70,145,68,113,158,92,86,42, 0,4076,11062,19401,23176,33576,34990,38966,42754,
chr1 201283451 201332993 NM_000299 0 + 201283702 201328836 0 15 453,104,395,145,208,178,63,115,156,177,154,187,85,107,2920, 0,10490,29714,33101,34120,35166,36364,36815,38526,39561,40976,41489,42302,45310,46622,
$ tail -2 hg38Tables.bed
chr22_KI270734v1_random 131493 137393 NM_005675 0 + 131645 136994 0 5 262,161,101,141,549, 0,342,3949,4665,5351,
chr22_KI270734v1_random 138078 161852 NM_016335 0 - 138479 161586 0 15 589,89,99,176,147,93,82,80,117,65,150,35,209,313,164, 0,664,4115,5535,6670,6925,8561,9545,10037,10335,12271,12908,18210,23235,23610,


== Deep learning ==
$ wc -l hg38CodingExon.bed
[https://www.nature.com/articles/s41576-019-0122-6 Deep learning: new computational modelling techniques for genomics]
577387 hg38CodingExon.bed
$ head -2 hg38CodingExon.bed
chr1 67093579 67093604 NM_001276352_cds_0_0_chr1_67093580_r 0 -
chr1 67096251 67096321 NM_001276352_cds_1_0_chr1_67096252_r 0 -
$ tail -2 hg38CodingExon.bed
chr22_KI270734v1_random 156288 156497 NM_016335_cds_12_0_chr22_KI270734v1_random_156289_r 0 -
chr22_KI270734v1_random 161313 161586 NM_016335_cds_13_0_chr22_KI270734v1_random_161314_r 0 -


= Terms =
# Focus on one NCBI refseq (https://www.ncbi.nlm.nih.gov/nuccore/444741698)
== RNA vs DNA ==
$ grep NM_001276352 hg38Tables.bed
* [https://medcitynews.com/2020/09/why-rna-is-a-better-measure-of-a-patients-current-health-than-dna/ Why RNA is a better measure of a patient’s current health than DNA]
chr1 67092175 67134971 NM_001276352 0 - 67093579 67127240 0 9 1429,70,145,68,113,158,92,86,42, 0,4076,11062,19401,23176,33576,34990,38966,42754,
* [http://www.hkcna.hk/content/2020/1216/868269.shtml 英美接種疫苗,陰謀論隨之盛行]. 核糖核酸=RNA. 脱氧核糖核酸=DNA. 輝瑞公司開發的新冠疫苗,是使用mRNA疫苗原理,即抽取病毒內部分核糖核酸編碼蛋白(或者稱信使核糖核酸)制成疫苗。
$ grep NM_001276352 hg38CodingExon.bed
** [https://vitals.lifehacker.com/how-mrna-vaccines-work-1845895792 How mRNA Vaccines Work]
chr1 67093579 67093604 NM_001276352_cds_0_0_chr1_67093580_r 0 -
** [https://www.acsh.org/news/2020/10/21/how-pfizers-rna-vaccine-works-15104 How Pfizer's RNA Vaccine Works]
chr1 67096251 67096321 NM_001276352_cds_1_0_chr1_67096252_r 0 -
** Pfizer’s Covid Vaccine: 11 Things You Need to Know
chr1 67103237 67103382 NM_001276352_cds_2_0_chr1_67103238_r 0 -
** [https://blog.ephorie.de/covid-19-vaccine-95-effective-it-doesnt-mean-what-you-think-it-means COVID-19 vaccine “95% effective”: It doesn’t mean what you think it means!]
chr1 67111576 67111644 NM_001276352_cds_3_0_chr1_67111577_r 0 -
chr1 67115351 67115464 NM_001276352_cds_4_0_chr1_67115352_r 0 -
chr1 67125751 67125909 NM_001276352_cds_5_0_chr1_67125752_r 0 -
chr1 67127165 67127240 NM_001276352_cds_6_0_chr1_67127166_r 0 -
</pre>


== 基因结构 ==
This can be compared to '''refGene'''(?) directly downloaded via http
https://zhuanlan.zhihu.com/p/49601643
<pre style="white-space: pre-wrap; /* CSS 3 */ white-space: -moz-pre-wrap; /* Mozilla, since 1999 */ white-space: -pre-wrap; /* Opera 4-6 */ white-space: -o-pre-wrap; /* Opera 7 */ word-wrap: break-word; /* IE 5.5+ */ " >
$ wget -c -O hg38.refGene.txt.gz http://hgdownload.soe.ucsc.edu/goldenPath/hg38/database/refGene.txt.gz
--2018-10-09 15:44:43--  http://hgdownload.soe.ucsc.edu/goldenPath/hg38/database/refGene.txt.gz
Resolving hgdownload.soe.ucsc.edu (hgdownload.soe.ucsc.edu)... 128.114.119.163
Connecting to hgdownload.soe.ucsc.edu (hgdownload.soe.ucsc.edu)|128.114.119.163|:80... connected.
HTTP request sent, awaiting response... 200 OK
Length: 7457957 (7.1M) [application/x-gzip]
Saving to: ‘hg38.refGene.txt.gz’


== PCR ==
hg38.refGene.txt.gz                100%[===============================================================>]  7.11M  901KB/s    in 10s
[https://unclegene6666.pixnet.net/blog/post/302562043 什麼是PCR? 聚合酶鏈鎖反應?] 基因叔叔


== Epidemiology ==
2018-10-09 15:44:54 (708 KB/s) - ‘hg38.refGene.txt.gz’ saved [7457957/7457957]
[https://www.bmj.com/about-bmj/resources-readers/publications/epidemiology-uninitiated Epidemiology for the uninitiated]


== in vivo ==
$ zcat hg38.refGene.txt.gz | wc -l
* [https://www.promocell.com/in-the-lab/human-primary-cells-and-immortal-cell-lines/ Human primary cells and immortal cell lines: differences and advantages]
75893
* [https://pediaa.com/what-is-the-difference-between-primary-cell-culture-and-cell-line/ What is the Difference Between Primary Cell Culture and Cell Line]
15:45PM /tmp$ zcat hg38.refGene.txt.gz | head -2
1072 NM_003288 chr20 + 63865227 63891545 63865365 63889945 7 63865227,63869295,63873667,63875815,63882718,63889189,63889849, 63865384,63869441,63873816,63875875,63882820,63889238,63891545, 0 TPD52L2 cmpl cmpl 0,1,0,2,2,2,0,
1815 NR_110164 chr2 + 161244738 161249050 161249050 161249050 2 161244738,161246874, 161244895,161249050, 0 LINC01806 unk unk -1,-1,


== in vitro ==
$ zcat hg38.refGene.txt.gz | tail -2
* https://en.wikipedia.org/wiki/In_vitro
1006 NM_130467 chrX + 55220345 55224108 55220599 55224003 5 55220345,55221374,55221766,55222620,55223986, 55220651,55221463,55221875,55222746,55224108, 0 PAGE5 cmpl cmpl 0,1,0,1,1,
* https://en.wikipedia.org/wiki/In_silico
637 NM_001364814 chrY - 6865917 6874027 6866072 6872608 7 6865917,6868036,6868731,6868867,6870005,6872554,6873971, 6866078,6868462,6868776,6868909,6870053,6872620,6874027, 0 AMELY cmpl cmpl 0,0,0,0,0,0,-1,
* https://en.wikipedia.org/wiki/RNA-Seq
</pre>


== RNA sequencing 101 ==
== Where to download reference genome ==
Web
* [http://hgdownload.cse.ucsc.edu/downloads.html UCSC] and [https://genome.ucsc.edu/goldenpath/help/twoBit.html twoBitToFa] to [https://www.biostars.org/p/9700/ UCSC] convert .2bit to fasta.
* [https://www.edx.org/course/introduction-to-biology-the-secret-of-life-24 Introduction to Biology - The Secret of Life] from edX. It's one of the top 100 best [https://www.classcentral.com/collection/top-free-online-courses free online courses] posted by ClassCentral.
* [http://hgdownload.cse.ucsc.edu/goldenPath/hg19/chromosomes/ hg19] from UCSC (chromosome-wise).
* [http://ctehr.tamu.edu/media/864063/jason-seq-pres.pdf Introduction to RNA-Seq] including biology overview (DNA, Alternative splcing, mRNA structure, human genome) and sequencing technology.
* [https://youtu.be/7BLS_YY9HeM Introduction to RNA-Seq for Researchers] (youtube)
* [http://www.chem.agilent.com/Library/eseminars/Public/RNA%20Sequencing%20101.pdf RNA Sequencing 101] by Agilent Technologies. Includes the definition of sequencing depth (number of reads per sample) and coverage (number of reads/locus).
* Where do we get reads(A,C,T,G) from sample RNA? See page 12 of this [https://www.biostat.wisc.edu/bmi776/lectures/rnaseq.pdf pdf] from Colin Dewey in U. Wisc.
* Quantification of RNA-Seq data (see the above pdf)
* Convert read counts into expression: RPKM (see the above pdf)
* RPKM and FPKM ([https://docs.google.com/file/d/0B23nQZpa5ce0ak9jNEdlMEVqemc/edit Data analysis of RNA-seq from new generation sequencing] by 張庭毓) RNA-Seq資料分析研討會與實作課程 / RNA Seq定序 / 次世代定序(NGS) / 高通量基因定序 分析.
* [http://yourgene.pixnet.net/blog/post/66237799 First vs Second] generation sequence.
* [http://sfg.stanford.edu/SFG.pdf The Simple Fool’s Guide to Population Genomics via RNA­Seq]: An Introduction to High­Throughput Sequencing Data Analysis. This covers QC, De novo assembly, BLAST, mapping reads to reference sequences, gene expression analysis and variant (SNP) detection.
* [http://nihlibrary.nih.gov/Services/Bioinformatics/Documents/Lipsett100928talk_web.pdf An Introduction to Bioinformatics Resources and their Practical Applications] from [http://nihlibrary.nih.gov/Services/Bioinformatics/Pages/default.aspx NIH library Bioinformatics Support Program].
* [http://www.rnaseqforthenextgeneration.org/resources/index.html Teaching material] from rnaseqforthenextgeneration.org which includes Designing RNA-Seq experiments, Processing RNA-Seq data, and Downstream analyses with RNA-Seq data.


== Books ==
== Which human reference genome to use? ==
* [http://www.amazon.com/RNA-seq-Data-Analysis-Mathematical-Computational/dp/1466595000 RNA-seq Data Analysis: A Practical Approach]. The pdf version is available on slideshare.net.
http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use (11/13/2017)
* [http://www.amazon.com/Statistical-Generation-Sequencing-Frontiers-Probability/dp/3319072110/ref=pd_bxgy_b_img_y Statistical Analysis of Next Generation Sequencing Data]
* [https://www.huber.embl.de/msmb/ Modern Statistics for Modern Biology] (free, see [[Statistics#Books_2|Statistics books]]). Plots are based on ggplot2.
* [https://github.com/harvardinformatics/learning-bioinformatics-at-home Learning Bioinformatics At Home] - some resources gathered by the Harvard Informatics group.
** Install all required packages using [https://www.huber.embl.de/msmb/ the R script] gives me errors. It would be great if there is a Docker image. Another solution is to run install.packages(pkgsToInstall, Ncpus=4) manually.
* [https://compgenomr.github.io/book/?s=09 Computational Genomics with R] by Altuna Akalin


== strand-specific vs non-strand specific experiment ==
== UHR, HBR ==
* http://seqanswers.com/forums/showthread.php?t=28025. According to this message and the [http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0126545 article] (under the paragraph of '''Read counting''') from PLOS, ''most of the RNA-seq protocols that are used nowadays are not strand-specific''.
In RNA sequencing (RNA-seq), Universal Human Reference (UHR) and Human Brain Reference (HBR) are two types of commercially available RNA samples that are often used as control samples and assess the performance and accuracy of RNA-seq assays. See [https://rnabio.org/module-01-inputs/0001/05/01/RNAseq_Data/ this] ([https://github.com/griffithlab/rnaseq_tutorial/wiki/RNAseq-Data github]) and [https://bioinformatics.ccr.cancer.gov/docs/b4b/Module2_RNA_Sequencing/Lesson13/ Lesson 13: Aligning raw sequences to reference genome].
* http://biology.stackexchange.com/questions/1958/difference-between-strand-specific-and-not-strand-specific-rna-seq-data
* https://www.biostars.org/p/61625/ how to find if this public rnaseq data are prepared by strand-specific assay?
* https://www.biostars.org/p/62747/ Discussion of using IGV to view strand-specific coverage. See also the similar posts on the right hand side.
* https://www.biostars.org/p/44319/ How To Find Stranded Rna-Seq Experiments Data. The text ''dUTP 2nd strand marking'' includes a link to stranded rna-seq data.
* forward (+)/ reverse(-) strand in GAlignments objects ([http://www.bioconductor.org/packages/release/bioc/manuals/GenomicAlignments/man/GenomicAlignments.pdf p68 of the pdf manual] and  [https://samtools.github.io/hts-specs/SAMv1.pdf page 7 of sam format specification].


Understand this info is necessary when we want to use summarizeOverlaps() function (GenomicAlignments) or htseq-count python program to get count data.
== GENCODE transcript database ==
* [https://www.gencodegenes.org/ GENCODE]
* [https://chitka-kalyan.blogspot.com/2014/02/creating-gencode-transcript-database-in.html Create a GENCODE transcript database in R]


[https://www.biostars.org/p/98756/ This post] mentioned to use [http://rseqc.sourceforge.net/ infer_experiment.py script] to check whether the rna-seq run is stranded or not.
== [https://en.wikipedia.org/wiki/RefSeq#RefSeq_categories RefSeq categories] ==
See Table 1 of [https://www.ncbi.nlm.nih.gov/books/NBK21091/ Chapter 18The Reference Sequence (RefSeq) Database].


The rna-seq experiment used in [http://www.bioconductor.org/help/workflows/rnaseqGene/ this tutorial] is not stranded-specific.
{| class="wikitable centered" style="text-align:center"
|+
|- class="hintergrundfarbe6"
! Category
! Description
|-
| NC
| Complete genomic molecules
|-
| NG
| Incomplete genomic region
|-
| NM
| [https://en.wikipedia.org/wiki/MRNA mRNA]
|-
| NR
| [https://en.wikipedia.org/wiki/Non-coding_RNA ncRNA]
|-  
| NP
| [https://en.wikipedia.org/wiki/Protein Protein]
|-
| XM
| predicted [[mRNA]] model
|-
| XR
| predicted [[ncRNA]] model
|-
| XP
| predicted [[Protein]] model (eukaryotic sequences)
|-
| WP
| predicted [[Protein]] model (prokaryotic sequences)
|}


== FASTQ ==
== UCSC version & NCBI release corresponding ==
* [http://en.wikipedia.org/wiki/FASTQ_format FASTQ=FASTA + Qual]. FASTQ format is a text-based format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores.
* http://genome.ucsc.edu/FAQ/FAQreleases.html
=== Phred quality score ===
q = -10log10(p) where p = <span style="color: red">error</span> probability for the base.
{| class="wikitable"
! q
! <span style="color: red">error</span> probability
! base call accuracy
|-
| 10
| 0.1
| 90%
|-
| 13
| 0.05
| 95%
|-
| 20
| 0.01
| 99%
|-
| 30
| 0.001
| 99.9%
|-
| 40
| 0.0001
| 99.99%
|-
| 50
| 0.00001
| 99.999%
|}


== FASTA ==
== Gene Annotation ==
fasta/fa files can be used as reference genome in IGV. But we cannot load these files in order to view them.
* [http://www.genecards.org/ GeneCards]
* [http://ghr.nlm.nih.gov/GenesBySymbol Genetics Home Reference] from National Library of Medicine
* [http://www.mycancergenome.org/ My Cancer Genome]
* [http://cancer.sanger.ac.uk/cosmic Cosmic]
* [http://www.gettinggeneticsdone.com/2015/11/annotables-convert-gene-ids.html annotables] R package.
* [https://academic.oup.com/bioinformatics/advance-article/doi/10.1093/bioinformatics/btz031/5301311?rss=1 ensembldb] R package
* https://www.gencodegenes.org/human/releases.html
* For gene symbols, there are NCBI and HUGO. See an example from GSE6532 (annot.tam object).


=== Download sequence files ===
{{Pre}}
* ftp://ftp.ncbi.nih.gov/genomes/H_sapiens/RNA/ Assembled genome sequence and annotation data for RefSeq genome assemblies
library(rtracklayer)
* ftp://ftp.ncbi.nlm.nih.gov/refseq/H_sapiens/
genes <- readGFF("gencode.v27.annotation.gff3.gz")
genes[1:2, 1:5]
# DataFrame with 2 rows and 5 columns
#      seqid  source      type    start      end
#  <factor> <factor>  <factor> <integer> <integer>
# 1    chr1  HAVANA gene          11869    14409
# 2    chr1  HAVANA transcript    11869    14409
genes[1:100, ] %>% filter(type == "gene") %>% dim()
# Error in UseMethod("filter") :
#  no applicable method for 'filter' applied to an object of class "c('DFrame', 'DataFrame', 'RectangularData', 'SimpleList', 'DataFrame_OR_NULL', 'List', 'Vector', 'list_OR_List', 'Annotated', 'vector_OR_Vector')"


=== Compute the sequence length of a FASTA file ===
library(ape)
https://stackoverflow.com/questions/23992646/sequence-length-of-fasta-file
genes2 <- read.gff("gencode.v27.annotation.gff3.gz")
<syntaxhighlight lang='bash'>
genes2[1:2, 1:5]
awk '/^>/ {if (seqlen){print seqlen}; print ;seqlen=0;next; } { seqlen += length($0)}END{print seqlen}' file.fa
#  seqid source      type start  end
# 1  chr1 HAVANA      gene 11869 14409
# 2  chr1 HAVANA transcript 11869 14409
genes2[1:100,]  %>% filter(type == "gene") %>% dim()
# [1] 11  9
</pre>


head -2 file.fa | \
=== Genecards ===
    awk '/^>/ {if (seqlen){print seqlen}; print ;seqlen=0;next; } { seqlen += length($0)}END{print seqlen}' | \
<ul>
    tail -1
<li>https://www.genecards.org/
</syntaxhighlight>
<li>Q: What are genes with gene symbols starting with LINC?; eg [https://www.genecards.org/cgi-bin/carddisp.pl?gene=LINC00491 LINC00491] </br>
A: Genes with gene symbols starting with "LINC" are long intergenic non-coding RNA (lncRNA) genes. lncRNAs are RNA molecules that are transcribed from the genome but '''do not encode proteins'''. Unlike protein-coding genes, lncRNAs do not have a well-defined coding sequence, but they do play important regulatory roles in cellular processes such as gene expression, chromatin structure, and genome stability. Some lncRNAs are specifically expressed in cancer cells and have been implicated in tumor development and progression, making them of interest for cancer research.
</ul>


== FASTA <=> FASTQ conversion ==
== How many [https://en.wikipedia.org/wiki/DNA DNA] strands are there in humans? ==
According to [https://www.quora.com/Bioinformatics-What-is-the-difference-between-fasta-fastq-and-sam-files this post],
* http://www.numberof.net/number-of-dna-strands/
* http://www.answers.com/Q/How_many_DNA_strands_are_there_in_humans


* FastA are text files containing multiple DNA* seqs each with some text, some part of the text might be a name.
== How many base pairs in human ==
* FastQ files are like  fasta, but they also have quality scores for each base of each seq, making them appropriate for reads from an Illumina machine (or other brands)
* 3 billion base pairs. https://en.wikipedia.org/wiki/Human_genome
* chromosome 22 has the smallest number of bps (~50 million).
* chromosome 1 has the largest number of bps (245 million base pairs).
* Illumina iGenome '''Homo_sapiens/UCSC/hg19/Sequence/WholeGenomeFasta/genome.fa''' file is 3.0GB (so is other genome.fa from human).


=== Convert FASTA to FASTQ without quality scores ===
== Gene, Transcript, Coding/Non-coding exon ==
* https://hslnews.wordpress.com/2015/07/02/bioinformatics-bite-how-to-find-the-transcription-start-site-of-a-gene/
* According to https://en.wikipedia.org/wiki/Exon, in the human genome only
** 1.1% of the genome is spanned by exons,
** 24% is in introns,
** 75% of the genome being intergenic DNA.
* https://twitter.com/ensembl/status/1276469013707665410?s=20


[https://www.biostars.org/p/99886/ Biostars]. For example, the [https://github.com/lh3/bioawk bioawk] by lh3 (Heng Li) worked.
== SNP ==
[https://en.wikipedia.org/wiki/Single-nucleotide_polymorphism Types of SNPs and number of SNPs in each chromosomes]


=== Convert FASTA to FASTQ with quality score file ===  
== NGS technology ==
See the links on the above post.
* [https://en.wikipedia.org/wiki/Illumina_(company) Illumina - Solexa]
* [https://en.wikipedia.org/wiki/ABI_Solid_Sequencing ABI - SOLiD]
* [https://en.wikipedia.org/wiki/454_Life_Sciences Roche 454]


=== Convert FASTQ to FASTA using Seqtk ===
== DNA methylation, Epigenetics ==
Use the [https://github.com/lh3/seqtk Seqtk] program; see [https://www.biostars.org/p/85929/ this post].
* Relation of methylation genes and gene expression
** Methylation of genes can have different effects on gene expression, depending on where the methylation occurs in the gene and the specific context of the gene and the cellular environment. Generally, '''methylation of ''promoter regions'' of genes is associated with reduced gene expression''', whereas methylation of ''gene body'' regions is less clearly associated with gene expression changes.
** When DNA is methylated at the promoter region of a gene, it can prevent the binding of transcription factors and RNA polymerase, which are necessary for transcription initiation. Methylation at the promoter region can also recruit proteins that block transcription or promote histone modifications that lead to chromatin compaction, further limiting access to the gene for transcriptional machinery.
** However, methylation in other regions of the gene, such as the gene body, can have more complex effects on gene expression. In some cases, gene body methylation can be associated with increased expression, while in other cases it may have no effect or even lead to decreased expression. It is thought that gene body methylation may be involved in regulating alternative splicing or RNA stability, among other possible mechanisms.
** Therefore, the effect of methylation on gene expression is not always straightforward and depends on various factors, including the specific gene, the location of methylation, and the cellular context.


The '''Seqtk''' program by lh3 can be used to sample reads from a fastq file including paired-end; see [https://www.biostars.org/p/69348/ this post].
* [https://wikidiff.com/hypermethylation/hypomethylation Hypermethylation vs Hypomethylation - What's the difference?]


== RPKM (Mortazavi et al. 2008) and cpm (counts per million) ==
*  [https://youtu.be/e4caywLliW0 DNA Methylation - Biochemistry (USMLE Step 1)]
Reads per Kilobase of Exon per Million of Mapped reads.
** DNA methylation = InActivates DNA transcription


* rpkm function in [https://support.bioconductor.org/p/59317/ edgeR] package.
* The level of mRNA expression is inversely related to the extent of methylation. See [https://www.future-science.com/doi/suppl/10.2144/btn-2018-0179/suppl_file/supplementary_figure_s6.pdf this screenshot example from TCGA]
* RPKM function in [https://support.bioconductor.org/p/50413/ easyRNASeq] package.
* TMM > cpm > log2 transformation on the paper [https://bmccancer.biomedcentral.com/track/pdf/10.1186/s12885-018-4546-8#page=3 Gene expression profiling of 1200 pancreatic ductal adenocarcinoma reveals novel subtypes]
* [https://en.wikipedia.org/wiki/RNA-Seq#Gene_expression_quantification Gene expression quantification] from RNA-Seq wikipedia page
** Sequencing depth/coverage: the total number of reads generated in a single experiment is typically normalized by converting counts to fragments, reads, or counts per million mapped reads ('''FPM, RPM, or CPM''').
** Gene length: '''FPKM, TPM'''. Longer genes will have more fragments/reads/counts than shorter genes if transcript expression is the same. This is adjusted by dividing the FPM by the length of a gene, resulting in the metric fragments per kilobase of transcript per million mapped reads (FPKM). When looking at groups of genes across samples, FPKM is converted to transcripts per million (TPM) by dividing each FPKM by the sum of FPKMs within a sample.
* [https://bioinformatics.stackexchange.com/a/2299 Difference between CPM and TPM and which one for downstream analysis?]. '''CPM''' is basically depth-normalized counts whereas '''TPM''' is length normalized (and then normalized by the length-normalized values of the other genes).
* [http://robpatro.com/blog/?p=235 The RNA-seq abundance zoo]. The counts per million ('''CPM''') metric takes the raw (or estimated) counts, and performs the first type of normalization I mention in the previous section.  That is, it normalized the count by the library size, and then multiplies it by a million (to avoid scary small numbers).


Idea
* [http://nathansheffield.com/wordpress/what-is-hemimethylated-dna/ hemimethylated DNA vs allele-specific methylation]. DNA-hemimethylation is when only one of two (complementary) strands is methylated.  
* The more we sequence, the more reads we expect from each gene. '''This is the most relevant correction of this method.'''
* [https://bioconductor.org/packages/devel/workflows/vignettes/methylationArrayAnalysis/inst/doc/methylationArrayAnalysis.html methylationArrayAnalysis ]: A cross-package Bioconductor workflow for analysing methylation array data
* Longer transcript are expected to generate more reads. '''The latter is only relevant for comparisons among different genes which we rarely perform!'''. As such, the DESeq2 only creates a size factor for each library and normalize the counts by dividing counts by a size factor (scalar) for each library. Note that: H0: mu1=mu2 is equivalent to H0: c*mu1=c*mu2 where c is gene length.
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-11-587 Comparison of Beta-value and M-value methods for quantifying methylation levels by microarray analysis] Du 2010. Figure 3 shows scatterplots of SD vs mean based on technical replicates of using beta or M-value. It can be seen M-value satisfies homoscedasticity but beta does not.
* [https://health.usnews.com/health-care/for-better/articles/is-your-dna-your-destiny-a-primer-on-epigenetics Is Your DNA Your Destiny? A Primer on Epigenetics]
* [https://en.wikipedia.org/wiki/GC-content GC content]  = (G+C)/(A+T+G+C) x 100%
* How many CpGs (C follows by G)?
* Some papers
** [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-021-04416-w Identification of prostate cancer specific methylation biomarkers from a multi-cancer analysis] 2021. Within all bootstrapped datasets, sites with non-zero coefficients in more than 99% LASSO models were kept.
* [http://genomicsclass.github.io/book/pages/methylation.html Analyzing DNA methylation data] (part of the book [http://genomicsclass.github.io/book/ Biomedical Data Science]) and the [https://www.class-central.com/mooc/1615/edx-ph525x-data-analysis-for-genomics PH525x: Data Analysis for Genomics] (edX course). The Github website is on https://github.com/genomicsclass/labs. The source code may not be correct. See also http://www.biostat.jhsph.edu/~iruczins/teaching/kogo/html/ml/week8/methylation.Rmd. The paper [http://ije.oxfordjournals.org/content/41/1/200.long Bump hunting to identify differentially methylated regions in epigenetic epidemiology studies] the tutorial has mentioned.
<source lang="rsplus">
devtools::install_github("coloncancermeth","genomicsclass")
library(coloncancermeth) # 485512 x 26
data(coloncancermeth) # load meth (methylation data), pd (sample info ) and gr objects
dim(meth)
dim(pd)
length(gr)
colnames(pd)
table(pd$Status) # 9 normals, 17 cancers
normalIndex <- which(pd$Status=="normal")
cancerlIndex <- which(pd$Status=="cancer")


Calculation
i=normalIndex[1]
# Count up the total reads in a sample and divide that number by 1,000,000 – this is our “per million” scaling factor.
plot(density(meth[,i],from=0,to=1),main="",ylim=c(0,3),type="n")
# Divide the read counts by the “per million” scaling factor. This normalizes for sequencing depth, giving you reads per million (RPM)
for(i in normalIndex){
# Divide the RPM values by the length of the gene, in kilobases. This gives you RPKM.
  lines(density(meth[,i],from=0,to=1),col=1)
}
### Add the cancer samples
for(i in cancerlIndex){
  lines(density(meth[,i],from=0,to=1),col=2)
}


Formula
# finding regions of the genome that are different between cancer and normal samples
<pre>
library(limma)
RPKM = (10^9 * C)/(N * L), with
X<-model.matrix(~pd$Status)
fit<-lmFit(meth,X)
eb <- ebayes(fit)


C = Number of reads mapped to a gene
# plot of the region surrounding the top hit
N = Total mapped reads in the experiment
library(GenomicRanges)
L = gene length in base-pairs for a gene
i <- which.min(eb$p.value[,2])
</pre>
middle <- gr[i,]
Index<-gr%over%(middle+10000)
cols=ifelse(pd$Status=="normal",1,2)
chr=as.factor(seqnames(gr))
pos=start(gr)


<syntaxhighlight lang="rsplus">
plot(pos[Index],fit$coef[Index,2],type="b",xlab="genomic location",ylab="difference")
source("http://www.bioconductor.org/biocLite.R")
matplot(pos[Index],meth[Index,],col=cols,xlab="genomic location")
biocLite("edgeR")
# http://www.ncbi.nlm.nih.gov/pubmed/22422453
library(edgeR)


set.seed(1234)
# within each chromosome we usually have big gaps creating subgroups of regions to be analyzed
y <- matrix(rnbinom(20,size=1,mu=10),5,4)
chr1Index <- which(chr=="chr1")
    [,1] [,2] [,3] [,4]
hist(log10(diff(pos[chr1Index])),main="",xlab="log 10 method")
[1,]    0    0    5    0
[2,]    6    2    7    3
[3,]    5  13    7    2
[4,]    3    3    9  11
[5,]    1    2    1  15


d <- DGEList(counts=y, lib.size=1001:1004)
library(bumphunter)
# Note that lib.size is optional
cl=clusterMaker(chr,pos,maxGap=500)
# By default, lib.size = colSums(counts)
table(table(cl)) ##shows the number of regions with 1,2,3, ... points in them
cpm(d) # counts per million
#consider two example regions#
  Sample1  Sample2  Sample3  Sample4
...
1   0.000    0.000 4985.045    0.000
</source>
2 5994.006  1996.008 6979.063  2988.048
3 4995.005 12974.052 6979.063  1992.032
4 2997.003  2994.012 8973.081 10956.175
5  999.001  1996.008  997.009 14940.239
> cpm(d,log=TRUE)
    Sample1  Sample2  Sample3  Sample4
1  7.961463  7.961463 12.35309  7.961463
2 12.607393 11.132027 12.81875 11.659911
3 12.355838 13.690089 12.81875 11.129470
4 11.663897 11.662567 13.17022 13.451207
5 10.285119 11.132027 10.28282 13.890078


d$genes$Length <- c(1000,2000,500,1500,3000)
=== Integrate DNA methylation and gene expression ===
rpkm(d)
* [https://bioconductor.org/packages/release/bioc/html/iNETgrate.html iNETgrate]: Integrates DNA methylation data with gene expression in a single gene network. [https://www.nature.com/articles/s41598-023-48237-8 Paper] 2023.
    Sample1  Sample2    Sample3  Sample4
* [https://bioconductor.org/packages/release/bioc/html/ELMER.html ELMER] Inferring Regulatory Element Landscapes and Transcription Factor Networks Using Cancer Methylomes and [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6546131/ Paper] 2019.
1    0.0000    0.000  4985.0449    0.000
* [https://www.nature.com/articles/s41392-019-0081-6 Integrative analysis of DNA methylation and gene expression identified cervical cancer-specific diagnostic biomarkers] 2019
2 2997.0030  998.004  3489.5314 1494.024
* [https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-018-4625-x EnrichedHeatmap: an R/Bioconductor package for comprehensive visualization of genomic signal associations] 2018
3 9990.0100 25948.104 13958.1256 3984.064
* [https://bioconductor.org/packages/release/bioc/vignettes/TCGAbiolinks/inst/doc/casestudy.html#Case_study_n_3:_Integration_of_methylation_and_expression_for_ACC TCGAbiolinks vignette]. Case 3. Create a scatterplot of log10(FDR gene expression) vs log10(FDR dna methylation). Case 4. ELMER - Identify putative target genes for differentially methylated distal probes, using methylation vs. expression correlation. Identify master regulatory Transcription Factors (TF) whose expression associate with DNA methylation changes at multiple regulatory regions.
4 1998.0020  1996.008  5982.0538 7304.117
5  333.0003  665.336  332.3363 4980.080


> cpm
== Whole Genome Sequencing, Whole Exome Sequencing, Transcriptome (RNA) Sequencing ==
function (x, ...)
* http://www.rna-seqblog.com/exome-sequencing-vs-rna-seq-to-identify-coding-region-variants/
UseMethod("cpm")
* http://www.rna-seqblog.com/combined-use-of-exome-and-transcriptome-sequencing/
<environment: namespace:edgeR>
* [http://www.genomebiology.com/2010/11/5/R57 A comparison of whole genome and whole transcriptome sequencing]
> showMethods("cpm")


Function "cpm":
== Sequence + Expression ==
<not an S4 generic function>
* [http://www.ncbi.nlm.nih.gov/pubmed/26177635 Integrated sequence and expression analysis of ovarian cancer structural variants underscores the importance of gene fusion regulation]
> cpm.default
function (x, lib.size = NULL, log = FALSE, prior.count = 0.25,
    ...)
{
    x <- as.matrix(x)
    if (is.null(lib.size))
        lib.size <- colSums(x)
    if (log) {
        prior.count.scaled <- lib.size/mean(lib.size) * prior.count
        lib.size <- lib.size + 2 * prior.count.scaled
    }
    lib.size <- 1e-06 * lib.size
    if (log)
        log2(t((t(x) + prior.count.scaled)/lib.size))
    else t(t(x)/lib.size)
}
<environment: namespace:edgeR>
> rpkm.default
function (x, gene.length, lib.size = NULL, log = FALSE, prior.count = 0.25,
    ...)
{
    y <- cpm.default(x = x, lib.size = lib.size, log = log, prior.count = prior.count)
    gene.length.kb <- gene.length/1000
    if (log)
        y - log2(gene.length.kb)
    else y/gene.length.kb
}
<environment: namespace:edgeR>
</syntaxhighlight>


Here for example the 1st sample and the 2nd gene, its rpkm value is calculated as
== Integrate RNA-Seq and DNA-Seq ==
<syntaxhighlight lang="rsplus">
* [https://www.jci.org/articles/view/96153 Integrated RNA and DNA sequencing reveals early drivers of metastatic breast cancer] by Perou. An R code is provided.
# step 1:
6/(1.0e-6 *1001) = 5994.006    # cpm, compute column-wise
# step 2:
5994.006/ (2000/1.0e3) = 2997.003 # rpkm, compute row-wise


# Another way
== Immunohistochemistry/IHC ==
# step 1 (RPK)
https://en.wikipedia.org/wiki/Immunohistochemistry. Protein expression by IHC.
6/ (2000/1.0e3) = 3
# step 2 (RPKM)
3/ (1.0e-6 * 1001) = 2997.003
</syntaxhighlight>


=== Critics ===
== Deconvolve bulk tumor tissue ==
* [http://faculty.ucr.edu/~tgirke/HTML_Presentations/Manuals/Workshop_Dec_12_16_2013/Rrnaseq/Rrnaseq.pdf RPKM/FPKM is not suitable for statistical testing] (p11):
* [https://www.biorxiv.org/content/10.1101/2022.12.04.519045v1 Performance of computational algorithms to deconvolve heterogeneous bulk tumor tissue depends on experimental factors]. [https://twitter.com/ariel_hippen/status/1602379847187107841 Twitter].
* [https://www.rna-seqblog.com/robustness-and-resilience-of-computational-deconvolution-methods-for-bulk-rna-sequencing-data/ Robustness and resilience of computational deconvolution methods for bulk RNA sequencing data] 2025


''Consider the following example: in two libraries, each with one million reads, gene X may have 10 reads for treatment A and 5 reads for treatment B, while it is 100x as many after sequencing 100 millions reads from each library. In the latter case we can be much more confident that there is a true difference between the two treatments than in the first one. However, the RPKM values would be the same for both scenarios. Thus, RPKM/FPKM are useful for reporting expression values, but not for statistical testing!''
== Tumor purity ==
* [https://aacrjournals.org/cancerrescommun/article/2/5/353/696472/Tumor-Purity-in-Preclinical-Mouse-Tumor Tumor Purity in Preclinical Mouse Tumor Models] 2022
* [https://ascopubs.org/doi/10.1200/PO.20.00016 Systematic Assessment of Tumor Purity and Its Clinical Implications] Haider 2020.
** With the exception of naive miRNA profiles, ''' ''purity estimates'' were inversely correlated with ''molecular profiles'' '''regardless of the underlying purity estimation profile .
** ''These data suggest that the presence of genomic and transcriptomic correlates of tumor purity are likely to confound biologic and clinical interpretations.''
* Estimators:
** DNA: ABSOLUTE, ASCAT, CLONET, INTEGER, OncoSNP
** RNA: DeMix, ISOpure-R (matlab/R), ESTIMATE ([https://bioinformatics.mdanderson.org/public-software/estimate/ Yoshihara, R])
** miRNA/microRNA: ISOpure-I
* TCGA purity estimate by Aran 2015 [https://www.nature.com/articles/ncomms9971 Systematic pan-cancer analysis of tumour purity] - Supplementary Data 1 (xlsx file with columns: Sample ID,Cancer type,ESTIMATE,ABSOLUTE,LUMP,IHC & CPE).
* [https://rdrr.io/bioc/TCGAbiolinks/man/Tumor.purity.html Tumor.purity: TCGA samples with their Tumor Purity measures] (a data frame with 9364 rows and 7 variables) from [https://www.bioconductor.org/packages/release/bioc/html/TCGAbiolinks.html TCGAbiolinks] package
* [https://academic.oup.com/bib/article/22/6/bbab163/6265216#312129108 Prediction of tumor purity from gene expression data using machine learning] 2021.
** We selected the '''CPE''' as the target variable, which is the median purity value after normalizing values from the other four purity estimates (ESTIMATE, ABSOLUTE, LUMP and IHC).
** our data set consisted of 8405 tumor samples.
* How VAF is related to tumor purity?
** '''Variant allelic fraction''' (VAF) is related to tumor purity because it reflects the proportion of cells in a sample that carry a specific genetic variant. In the context of cancer, '''VAF can be used as a surrogate marker for tumor purity''', as the fraction of cells in the sample that carry the variant will depend on the proportion of cancer cells relative to normal cells.
** The VAF of a specific genetic variant in a cancer sample can be calculated as the ratio of the number of reads supporting the variant to the total number of reads covering that locus. '''In a sample that is purely composed of cancer cells, the VAF should approach 1''', as all cells will carry the variant. In a sample that is mixed with normal cells, the VAF will be lower and proportional to the proportion of cancer cells in the sample.
** Therefore, by measuring the VAF of one or more genetic variants, it is possible to estimate the tumor purity, which is the proportion of cancer cells in the sample relative to normal cells. This information is important for a variety of downstream analyses, including '''variant calling''', gene expression analysis, and the estimation of the '''mutational burden''', as it can affect the interpretation of the results and the accuracy of the analysis.
* How gene expression can be used to estimate tumor purity?
** Gene expression analysis can be used to estimate tumor purity by comparing the expression levels of genes known to be specific to either '''normal or cancer cells'''. In a sample that is mixed with normal and cancer cells, the expression levels of these genes will reflect the proportion of normal and cancer cells present in the sample.
** For example, genes that are highly expressed in '''normal cells''', such as '''housekeeping genes''', can be used as a reference to estimate the proportion of normal cells in the sample. Similarly, genes that are highly expressed in '''cancer cells''', such as '''oncogenes''', can be used to estimate the proportion of cancer cells in the sample.
** The relative expression levels of these genes can then be used to estimate the tumor purity, either by comparing the expression levels to a reference sample of known purity, or by using mathematical models to estimate the proportion of normal and cancer cells in the sample.
** It is important to note that this method is not without limitations, as the expression levels of specific genes can be influenced by various factors, such as the presence of cell-to-cell heterogeneity, gene amplification, and epigenetic modifications, among others. Therefore, gene expression analysis should be used in combination with other methods, such as copy number analysis and variant allelic fraction analysis, to obtain a more accurate estimate of tumor purity.
* Some papers
** [https://onlinelibrary.wiley.com/doi/full/10.1002/cam4.3505 Tumor purity as a prognosis and immunotherapy relevant feature in gastric cancer]
** [https://genomemedicine.biomedcentral.com/articles/10.1186/gm524 Identifying driver mutations in sequenced cancer genomes: computational approaches to enable precision medicine]. Tumor purity affects the detection of somatic mutations. Explain in plot about what are heterozygous somatic SNV and one hetererozygous germline SNV.
<ul>
<li>ISOpureR (Quon 2013): intensity or count data. Error term <math>e_n</math> multinomial distribution.
<pre>
library(ISOpureR)


* [http://blog.nextgenetics.net/?e=51 RPKM measure is inconsistent among samples]
# For reproducible results, set the random seed
set.seed(123);


=== (another critic) Union Exon Based Approach ===
# Run ISOpureR Step 1 - Cancer Profile Estimation
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0141910
system.time(ISOpureS1model <- ISOpure.step1.CPE(
  tumor.expression.data,  # intensity or count data
  normal.expression.data  # intensity or count data
))
ISOpureS1model$alphapurities  # tumor purity estimates
</pre>
</li>
<li>ESTIMATE (Yoshihara 2013): normalized data.
* Since it is based ssGSEA, only ranks are used. It does not matter we used the log transformed or count data.
* ssGSEA is based on two gene signatures: Stromal signature (141 genes) and immune signature (141 genes)
* The formula for calculating ESTIMATE tumor purity was developed in TCGA Affymetrix data (n=1001) including both the '''ESTIMATE score''' and '''ABSOLUTE-based tumor purity'''.
* An evolutionary algorithm was used for the mathematical model.
* Nonlinear least squares method was used to determine the final model estimate.
* Tumor purity = cos(0.6 + 0.000146 * ESTIMATE score)
<pre>
library(estimate)
OvarianCancerExpr <- system.file("extdata", "sample_input.txt", package="estimate")
filterCommonGenes(input.f=OvarianCancerExpr, output.f="OV_10412genes.gct", id="GeneSymbol")
estimateScore("OV_10412genes.gct", "OV_estimate_score.gct", platform="affymetrix")


In general, the methods for gene quantification can be largely divided into two categories: transcript-based approach and ‘union exon’-based approach.
plotPurity(scores="OV_estimate_score.gct", samples="s516", platform="affymetrix")


It was found that the gene expression levels are significantly underestimated by ‘union exon’-based approach, and the average of RPKM from ‘union exons’-based method is less than 50% of the mean expression obtained from transcript-based approach.
scan("OV_estimate_score.gct", "", skip=6)[-c(1:2)] |> as.numeric() # tumor purity estimates
</pre>
</li>
<li>[https://wwylab.github.io/DeMixT/tutorial.html DeMixT] (Wang 2018): count data. [https://www.nature.com/articles/s41587-022-01342-x Estimation of tumor cell total mRNA expression in 15 cancer types predicts disease progression], [https://www.nature.com/articles/s41587-022-01342-x Cao 2022] for profile likelihood method & supplementary information for more information about the benchmarking between DeMixT_DE and DeMixT_GS.
<pre>
library(DeMixT)
source("DeMixT_preprocessing.R")


== FPKM (Trapnell et al. 2010) ==
count.mat <- cbind(normal.expression.data, tumor.expression.data)
colnames(count.mat) <- paste0("sample", 1:ncol(count.mat))


Fragment per Kilobase of exon per Million of Mapped fragments (Cufflinks).
label = factor(c(rep('Normal', ncol(normal.expression.data)),
FPKM is very similar to RPKM. RPKM was made for single-end RNA-seq, where every read corresponded to a single fragment that was sequenced. FPKM was made for paired-end RNA-seq. With paired-end RNA-seq, two reads can correspond to a single fragment, or, if one read in the pair did not map, one read can correspond to a single fragment. The only difference between RPKM and FPKM is that FPKM takes into account that two reads can map to one fragment (and so it doesn’t count this fragment twice).
                rep('Tumor', ncol(tumor.expression.data))))
set.seed(1234) # not sure if this is needed
preprocessed_data = DeMixT_preprocessing(count.mat, label)
PRAD_filter = preprocessed_data$count.matrix


== [http://www.rna-seqblog.com/rpkm-fpkm-and-tpm-clearly-explained/ RPKM, FPKM, TPM and DESeq] ==
set.seed(1234)
* The youtube video is on [https://www.youtube.com/watch?t=119&v=TTUrtCY2k-w here]. TPM 比 RPKM/FPKM 好因為 total reads in each experiments are the same.
Normal.id <- paste0("sample", 1:n1)
* [https://reneshbedre.github.io/blog/expression_units.html Relationship (formula) between RPKM and TPM]
Tumor.id <- paste0("sample", (n1+1):(n1+n2))
* [https://arxiv.org/pdf/1804.06050.pdf#page=5 Differences]
data.Y = SummarizedExperiment(assays = list(counts = PRAD_filter[, Tumor.id]))
** The main difference between RPKM and FPKM is that the former is a unit based on single-end reads, while the latter is based on paired-end reads and counts the two reads from the same RNA fragment as one instead of two.
data.N1 <- SummarizedExperiment(assays = list(counts = PRAD_filter[, Normal.id]))
** The difference between RPKM/FPKM and TPM is that the former calculates sample-scaling factors before dividing read counts by gene lengths, while the latter divides read counts by gene lengths first and calculates samples calling factors based on the length-normalized read counts.
res = DeMixT(data.Y = data.Y,
** If researchers would like to interpret gene expression levels as the proportions of RNA molecules from different genes in a sample,
            data.N1 = data.N1,
* [https://zhuanlan.zhihu.com/p/55988984 为什么说FPKM和RPKM都错了?]
            nthread = 64,
* [http://diytranscriptomics.com/Reading/files/wagnerTPM.pdf Measurement of mRNA abundance using RNA-seq data: RPKM measure is inconsistent among samples] (TPM method) by Wagner 2012.
            gene.selection.method = "DE") # default is "GS"
* Between samples normalization.  
res$pi[2, ] # tumor purity estimates
** [https://groups.google.com/forum/#!topic/sailfish-users/jBf9SGiH1AM How to Normalize Salmon TPM output?]
</pre>
** [https://www.biostars.org/p/287296/ How do I normalize for my RNA-seq data across different samples in different conditions]. Using DESeq2 ([https://genomebiology.biomedcentral.com/track/pdf/10.1186/s13059-014-0550-8 paper], [https://www.rdocumentation.org/packages/DESeq2/versions/1.12.3/topics/estimateSizeFactors estimateSizeFactors()]). [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3218662/pdf/gb-2010-11-10-r106.pdf DESeq] paper by Anders 2010 where the NB model and size factor was first used.
</li>
: <syntaxhighlight lang='rsplus'>
<li>[https://cibersortx.stanford.edu/ CIBERSORTx] (Newman 2019). Web only. [https://www.nature.com/articles/s41587-019-0114-2 Determining cell type abundance and expression from bulk tissues with digital cytometry]
> dds <- makeExampleDESeqDataSet(m=4)
<li>PUREE (Revkov 2023). [https://github.com/skandlab/PUREE Python-based]. Only API, no source code.
> head(counts(dds))
</li>
      sample1 sample2 sample3 sample4
</ul>
gene1      0      1      1      6
gene2      2      0      0      3
gene3      18      9      19      12
gene4      12      25      13      13
gene5      22      26      10      8
gene6      6      5      8      6
> dds <- estimateSizeFactors(dds)
> head(counts(dds))
      sample1 sample2 sample3 sample4
gene1      0      1      1      6
gene2      2      0      0      3
gene3      18      9      19      12
gene4      12      25      13      13
gene5      22      26      10      8
gene6      6      5      8      6
> head(counts(dds, normalized=TRUE))
      sample1    sample2    sample3  sample4
gene1  0.00000  0.9654796  0.9858756  5.732657
gene2  1.96066  0.0000000  0.0000000  2.866328
gene3 17.64594  8.6893164 18.7316365 11.465314
gene4 11.76396 24.1369899 12.8163829 12.420756
gene5 21.56726 25.1024695  9.8587560  7.643542
gene6  5.88198  4.8273980  7.8870048  5.732657
</syntaxhighlight>
* TPM (generated by [https://deweylab.github.io/RSEM/ RSEM] or [https://combine-lab.github.io/salmon/ Salmon] or [https://pachterlab.github.io/kallisto/starting Kallisto]) has been suggested as a better unit than RPKM/FPKM. But it cannot be used to do comparison between samples.  
** [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3163565/ RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome] Li 2011, 8k citations from google scholar.
** [http://www.arrayserver.com/wiki/index.php?title=TPM_and_FPKM TPM and FPKM] from array suite wiki
** [https://haroldpimentel.wordpress.com/2014/05/08/what-the-fpkm-a-review-rna-seq-expression-units/ What the FPKM? A review of RNA-Seq expression units]. R code for computing effective counts, TPM, and FPKM.
** [https://haroldpimentel.wordpress.com/2014/12/08/in-rna-seq-2-2-between-sample-normalization/ In RNA-Seq, 2 != 2: Between-sample normalization]. Among the most popular and well-accepted BSN (between-sample normalization) methods are TMM and DESeq normalization.
: <syntaxhighlight lang='bash'>
P -- per
K -- kilobase (related to gene length)
M -- million (related to sequencing depth)
</syntaxhighlight>
* [https://www.biostars.org/p/329625/ How to convert transcript level TPM to gene level TPM ?]
* [https://github.com/crazyhottommy/RNA-seq-analysis/blob/master/salmon_kalliso_STAR_compare.md R scripts to convert HTseq counts to TPM]
* [https://www.biostars.org/p/171766/ Calculating TPM from featureCounts output]
* [https://hbctraining.github.io/DGE_workshop_salmon/lessons/02_DGE_count_normalization.html Comparison of common normalization methods] from a workshop from Harvard Chan Bioinformatics Core.
* [https://rnajournal.cshlp.org/content/early/2020/04/13/rna.074922.120 Misuse of RPKM or TPM normalization when comparing across samples and sequencing protocols] Zhao 2020
* [https://reneshbedre.github.io/blog/expression_units.html#tmm-trimmed-mean-of-m-values Gene expression units explained: RPM, RPKM, FPKM, TPM, DESeq, TMM, SCnorm, GeTMM, and ComBat-Seq]


== TMM (Robinson and Oshlack, 2010) ==  
== Integrate/combine Omics ==
Trimmed Means of M values (edgeR).
* [https://github.com/mikelove/awesome-multi-omics?s=09 awesome-multi-omics] by Michael Love
<ul>
* [https://journals.plos.org/ploscompbiol/article?id=10.1371%2Fjournal.pcbi.1011224 Ten quick tips for avoiding pitfalls in multi-omics data integration analyses] 2023
<li>[https://www.tutorialspoint.com/statistics/trimmed_mean.htm Trimmed Mean] </li>
* [http://www.bioconductor.org/packages/release/data/experiment/html/BloodCancerMultiOmics2017.html BloodCancerMultiOmics2017]. "Drug-perturbation-based stratification of blood cancer" by Dietrich S, Oles M, Lu J et al. - experimental data and complete analysis.
<li>[https://web.stanford.edu/class/bios221/labs/rnaseq/lab_4_rnaseq.html RNA Sequence Analysis in R: edgeR]
* [https://cran.r-project.org/web/packages/OmicsPLS/index.html OmicsPLS] & [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2371-3 the paper] in BMC Bioinformatics 2018
</li>
* [https://bioconductor.org/packages/release/bioc/html/MultiAssayExperiment.html MultiAssayExperiment] & [http://cancerres.aacrjournals.org/content/77/21/e39 the paper] in AACR 2017
<li>[https://davetang.org/muse/2011/01/24/normalisation-methods-for-dge-data/ Normalisation methods implemented in edgeR]. TMM, RLE, Upper-quartile. </li>
** [https://waldronlab.io/MultiAssayWorkshop/ Multi-omic Integration and Analysis of cBioPortal and TCGA data with MultiAssayExperiment] from [https://bioc2020.bioconductor.org/workshops.html Bioc2020]
<li>Using [https://stats.stackexchange.com/a/421903 edgeR] package
* [https://cran.r-project.org/web/packages/mixOmics/index.html mixOmics], http://mixomics.org/, [https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1005752 the paper] on PLOS 2017
<pre>
* [https://academic.oup.com/biostatistics/advance-article/doi/10.1093/biostatistics/kxy044/5092386 The impact of different sources of heterogeneity on loss of accuracy from genomic prediction models] Biostatistics 2018
library(magrittr)
* [https://cran.r-project.org/web/packages/tweedie/ Tweedieverse], [https://github.com/himelmallick/Tweedieverse/ Github]
library(edgeR)
* [https://www.nature.com/articles/ncomms6901#Sec17 Combining gene mutation with gene expression data improves outcome prediction in myelodysplastic syndromes] 2015, [https://github.com/gerstung-lab/MDS-expression R code for Supplementary Data 2 and 4] and [https://github.com/mg14/mg14 mg14.R].
set.seed(1)
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-021-04268-4 A comprehensive database for integrated analysis of omics data in autoimmune diseases] 2021
M <- matrix(rnbinom(10000,mu=5,size=2), ncol=4)
* [https://academic.oup.com/bioinformatics/article/37/17/2601/6157728 Integrative survival analysis of breast cancer with gene expression and DNA methylation data] Bichindaritz, 2021
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-022-05127-6 Machine learning to analyse omic-data for COVID-19 diagnosis and prognosis] 2023


out <- DGEList(M) %>% calcNormFactors() %>% cpm()
== Gene expression ==
</pre> </li>
Expression level is the amount of RNA in cell that was transcribed from that gene. [https://speakerdeck.com/alyssafrazee/high-resolution-gene-expression-analysis Slides] from Alyssa Frazee.
<li>Using [https://www.bioconductor.org/packages/release/bioc/vignettes/NOISeq/inst/doc/NOISeq.pdf#page=15 NOISeq] package
<pre>
library(NOISeq)
out2 <- tmm(M, long = 1000, lc = 0, k = 0)
out[1:3, 1:3] / out2[1:3, 1:3]
#    Sample1  Sample2  Sample3
# 1 80.81611 81.32609      NaN
# 2 80.81611 81.32609 80.81611
# 3 80.81611      NaN 80.81611
</pre> </li>
</ul>


== Sample size ==
== Fusion gene ==
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2445-2 Empirical assessment of the impact of sample number and read depth on RNA-Seq analysis workflow performance]
* https://en.wikipedia.org/wiki/Fusion_gene
* https://github.com/STAR-Fusion/STAR-Fusion,
* Gene fusion discovery
** [https://youtu.be/TzjxFkDHO4M?t=3713 Fusion prediction accuracy] comparison.
** [https://youtu.be/TzjxFkDHO4M?t=4686 Fusion gene visualized in IGV]
* [https://bioconductor.org/packages/release/bioc/html/chimeraviz.html chimeraviz] Visualization tools for gene fusions
* [https://youtu.be/5V-NMDvR2l8?t=1432 Tools to call fusions] & Common issues with fusion calling, [https://youtu.be/5V-NMDvR2l8?t=3151 visualizing fusion events in IGV]
 
== Structural variation ==
* https://en.wikipedia.org/wiki/Structural_variation
* https://www.ncbi.nlm.nih.gov/dbvar/content/overview/
* [https://www.biorxiv.org/content/biorxiv/early/2018/02/01/200170.full.pdf Detection of complex structural variation from paired-end sequencing data] Joseph G. Arthur, 2018
 
[https://github.com/arq5x/lumpy-sv LUMPY], [https://github.com/dellytools/delly DELLY], [https://sites.google.com/site/sebatlab/software-data ForestSV], [http://gmt.genome.wustl.edu/packages/pindel/ Pindel], [http://breakdancer.sourceforge.net/ breakdancer] , [http://svdetect.sourceforge.net/Site/Home.html SVDetect].


== Coverage ==
== Covid-19 ==
* [https://genohub.com/recommended-sequencing-coverage-by-application/ Recommended Coverage and Read Depth for NGS Applications] from @Genohub.
[https://www.rna-seqblog.com/bulk-rna-sequencing-for-analysis-of-post-covid-19-condition/ Bulk RNA sequencing for analysis of post COVID-19 condition] 2024. 13 differentially expressed genes associated with PCC (long Covid) were found. Enriched pathways were related to interferon-signalling and anti-viral immune processes.
* [http://bedtools.readthedocs.org/en/latest/content/tools/coverage.html bedtools]. The bedtools is now hosted on [https://github.com/arq5x/bedtools2 github]
* https://github.com/alyssafrazee/polyester
<pre>
~20x coverage ----> reads per transcript = transcriptlength/readlength * 20
</pre>
* Page 18 of this [http://www.chem.agilent.com/Library/eseminars/Public/RNA%20Sequencing%20101.pdf RNA-Seq 101] from Agilent or [http://res.illumina.com/documents/products/technotes/technote_coverage_calculation.pdf Estimating Sequencing Coverage] from Illumina.
<pre>
C = L N / G
</pre>
where L=read length, N =number of reads and G=haploid genome length. So, if we take one lane of single read human sequence with v3 chemistry, we get C = (100 bp)*(189×10^6)/(3×10^9 bp) = 6.3. This tells us that each base in the genome will be sequenced between six and seven times on average.
* coverage() function in IRanges package.
* [https://github.com/fbreitwieser/bamcov bamcov] - Quickly calculate and visualize sequence coverage in alignment files
* [https://www.biostars.org/p/6571/ Coverage and read depth]
* [https://www.biostars.org/p/638/ What Is The Sequencing 'Depth' ?] Coverage = (total number of bases generated) / (size of genome sequenced). So a 30x coverage means, on an average each base has been read by 30 sequences.
* [http://www.nature.com/nrg/journal/v15/n2/full/nrg3642.html Sequencing depth and coverage: key considerations in genomic analyses]
* [http://qualimap.bioinfo.cipf.es/doc_html/index.html Qualimap]
* https://www.biostars.org/p/5165/
<syntaxhighlight lang='bash'>
# Assume the bam file is sorted by chromosome location
# took 40 min on 5.8G bam file. samtools depth has no threads option:(
# it is not right since it only account for regions that were covered with reads
samtools depth  *bamfile*  |  awk '{sum+=$3} END { print "Average = ",sum/NR}'    # maybe 42


# The following is the right way! The result matches with Qualimap program.
== RNASeq + ChipSeq ==
samtools depth -a *bamfile*  |  awk '{sum+=$3} END { print "Average = ",sum/NR}'  # maybe 8
* [http://www.nature.com/jhg/journal/vaop/ncurrent/full/jhg201584a.html Elucidating the mechanisms of transcription regulation during heart development by next-generation sequencing]
# OR
LEN=`samtools view -H bamfile | grep -P '^@SQ' | cut -f 3 -d ':' | awk '{sum+=$1} END {print sum}'`  # 3095693981
SUM=`samtools depth bamfile | awk '{sum+=$3} END { print "Sum = ", sum}'`  # 24473867730
echo $(( $LEN/$SUM ))
</syntaxhighlight>


== SAM/Sequence Alignment Format and BAM format specification ==
== Labs ==
* https://samtools.github.io/hts-specs/SAMv1.pdf and [http://samtools.sourceforge.net/ samtools] webpage.
* [http://salzberg-lab.org/courses/ Steven Salzberg]
* http://genome.sph.umich.edu/wiki/SAM


== Single-end, pair-end, fragment, insert size ==
== Biowulf2 at NIH ==
* [http://thegenomefactory.blogspot.com/2013/08/paired-end-read-confusion-library.html Paired-end read confusion - library, fragment or insert size?]
* Main site: http://hpc.nih.gov
* https://www.biostars.org/p/95803/
* User guide: https://hpc.nih.gov/docs/user_guides.html
* Unlock account (60 days inactive) https://hpc.nih.gov/dashboard/
* Transitioning from PBS to Slurm: https://hpc.nih.gov/docs/pbs2slurm.html
* Job Submission 'cheat sheet': https://hpc.nih.gov/docs/biowulf2-handout.pdf
* STAR: https://hpc.nih.gov/apps/STAR.html


== Germline vs Somatic mutation ==
== [https://github.com/DecodeGenetics/BamHash BamHash] ==
Germline: inherit from parents. See the [https://en.wikipedia.org/wiki/Germline Wikipedia] page.
Hash BAM and FASTQ files to verify data integrity. The C++ code is based on OpenSSL and seqan libraries.


== Driver vs passenger mutation ==
== Reproducibility ==
https://en.wikipedia.org/wiki/Somatic_evolution_in_cancer
* [https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1007881 Improving reproducibility in computational biology research]
* [http://www.biorxiv.org/content/early/2017/07/19/165191 SnakeChunks: modular blocks to build Snakemake workflows for reproducible NGS analyses] by Claire Rioualen et al, 2017.


== Nonsynonymous mutation ==
== Selected Papers ==
It is related to the [http://www.chemguide.co.uk/organicprops/aminoacids/dna4.html genetic code], [https://en.wikipedia.org/wiki/Genetic_code Wikipedia]. There are 20 amino acids though there are 64 codes.  
* [http://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-0961-5 Testing for association between RNA-Seq and high-dimensional data] and the Bioconductor package globalSeq.
 
* [http://link.springer.com/article/10.1208%2Fs12248-016-9917-y The FDA’s Experience with Emerging Genomics Technologies—Past, Present, and Future]
See
* [http://www.nature.com/nbt/journal/v31/n1/abs/nbt.2450.html Differential analysis of gene regulation at transcript resolution with RNA-seq] Trapnell et al, Nature Biotechnology 31, 46–53 (2013)
* http://evolution.about.com/od/Overview/a/Synonymous-Vs-Nonsynonymous-Mutations.htm
* [http://cancerres.aacrjournals.org/content/early/2016/12/01/0008-5472.CAN-16-1624.long A Study of TP53 RNA Splicing Illustrates Pitfalls of RNA-seq Methodology]
* https://en.wikipedia.org/wiki/Nonsynonymous_substitution
* [http://www.rna-seqblog.com/top-rna-seq-articles-2016/ Top RNA-Seq Articles – 2016] from RNA-Seq blog
* [http://thegenomefactory.blogspot.com/2013/10/understanding-snps-and-indels-in.html Understanding SNPs and INDELs in microbial genomes]
* [http://onlinelibrary.wiley.com/doi/10.1111/biom.12745/full Multivariate association analysis with somatic mutation data] by He 2017 Biometrics.
* An example from https://en.wikipedia.org/wiki/Silent_mutation
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-3433-x RASflow – An RNA-Seq Analysis Workflow with Snakemake] Zhang 2019
** nonsynonymous: ATG to GTG mutation (AUG = Met, GUG = Val)
* [http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0157989 A Survey of Bioinformatics Database and Software Usage through Mining the Literature]
** synonymous: CAT to CAC mutation (CAU = His, CAC = His)
* [https://www.nature.com/articles/s41576-021-00431-y Computational analysis of cancer genome sequencing data] Cortés-Ciriano 2021. Focus on point mutations, copy number alterations, structural variations. For RNA-seq data, it focused on gene fusion detection.


== isma: analysis of mutations detected by multiple pipelines ==
== Pictures ==
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2701-0 isma]: an R package for the integrative analysis of mutations detected by multiple pipelines
https://www.flickr.com/photos/genomegov


== Tumor mutational burden ==
== FISH/Fluorescence In Situ Hybridization ==
* [https://cancerci.biomedcentral.com/articles/10.1186/s12935-020-01472-9 Significance of tumor mutation burden combined with immune infiltrates in the progression and prognosis of ovarian cancer]
* [https://www.genome.gov/genetics-glossary/Fluorescence-In-Situ-Hybridization
* [https://bioconductor.org/packages/release/bioc/vignettes/maftools/inst/doc/maftools.html maftools] Summarize, Analyze and Visualize MAF Files
* [https://youtu.be/b81DcJC1jAs Fluorescent In Situ Hybridization (FISH) Assay]
* [https://www.biomedcentral.com/search?query=TMB&searchType=publisherSearch 2449 result(s) for 'TMB'] from BMC
* [https://www.biostars.org/p/431067/ How to calculate TMB for somatic data TCGA]
* [https://www.biostars.org/p/299549/ Question: TMB Tumor Mutation Burden]
* [https://pubmed.ncbi.nlm.nih.gov/32239176/ Mining TCGA database for tumor mutation burden and their clinical significance in bladder cancer]


== Missense variants ==
== 用DNA做身分鑑識 ==
aminoacid changing variants
[https://www.worldjournal.com/5120826/article-《社會傳真》用dna做身分鑑識/ 用DNA做身分鑑識]


== Alternative and differential splicing ==
== 如何自学入门生物信息学 ==
[http://www.rna-seqblog.com/best-practices-and-appropriate-workflows-to-analyse-alternative-and-differential-splicing/ Best practices and appropriate workflows to analyse alternative and differential splicing]
* https://zhuanlan.zhihu.com/p/32065916
* [http://juang.bst.ntu.edu.tw/JRH/biotech.htm 生物技術簡介]


== Allele vs Gene ==
== CRISPR ==
http://www.diffen.com/difference/Allele_vs_Gene
[https://health.udn.com/health/story/6008/6028809 基因編輯的原理是什麼?一次看懂基因神剪CRISPR]


* A gene is a stretch of DNA or RNA that determines a certain trait.
== Staying current ==
* Genes mutate and can take two or more alternative forms; an '''allele''' is one of these forms of a gene. For example, the gene for eye color has several variations (alleles) such as an allele for blue eye color or an allele for brown eyes.
[http://www.gettinggeneticsdone.com/2017/02/staying-current-in-bioinformatics-genomics-2017.html Staying Current in Bioinformatics & Genomics: 2017 Edition]
* An allele is found at a fixed spot on a chromosome?
* Chromosomes occur in pairs so organisms have two alleles for each gene — one allele in each chromosome in the pair. Since each chromosome in the pair comes from a different parent, organisms inherit one allele from each parent for each gene. The two alleles inherited from parents may be same (homozygous) or different (heterozygotes).


== Locus ==
== Papers ==
https://en.wikipedia.org/wiki/Locus_(genetics)
* [http://www.nature.com/nature/journal/vaop/ncurrent/full/nature24286.html DNA sequencing at 40: past, present and future]


== [https://en.wikipedia.org/wiki/Haplotype Haplotypes] ==
== Common issues in algorithmic bioinformatics papers ==
* http://www.brown.edu/Research/Istrail_Lab/proj_cmsh.php
[http://medvedevgroup.com/2019/08/11/what-are-some-common-issues-i-find-when-reviewing-algorithmic-bioinformatics-conference-papers/ What are some common issues I find when reviewing algorithmic bioinformatics conference papers?]
* http://www.nature.com/nri/journal/v5/n1/fig_tab/nri1532_F2.html
* https://www.sciencenews.org/article/seeking-genetic-fate
* http://www.medscape.com/viewarticle/553400_3


== Base quality, Mapping quality, Variant quality ==
== Precision Medicine courses ==
* Fastq base quality: https://en.wikipedia.org/wiki/FASTQ_format
* [https://gmi.ucsf.edu/cme-outreach/ UCSF]
* Mapping quality: http://genome.cshlp.org/content/18/11/1851.long
* [http://openonlinecourses.com/ehr/PrecisionAndPredictiveMedicine.asp Precision & Predictive Medicine]
* Variant quality: http://www.ncbi.nlm.nih.gov/pubmed/21903627


== Mapping quality (MAPQ) vs Alignment score (AS) ==
== Personalized medicine ==
http://seqanswers.com/forums/showthread.php?t=66634 & [https://samtools.github.io/hts-specs/SAMv1.pdf SAM format specification]
* [https://www.nytimes.com/2017/08/30/health/gene-therapy-cancer.html F.D.A. Approves First Gene-Altering Leukemia Treatment]
* [http://time.com/4989537/blood-cancer-gene-therapy/ The FDA Just Approved a New Way of Fighting (lymphoma) Cancer Using Personalized Gene Therapy]
* [https://ghr.nlm.nih.gov/primer/precisionmedicine/precisionvspersonalized What is the difference between precision medicine and personalized medicine? What about pharmacogenomics?] "personalized medicine" is an older term. [https://ghr.nlm.nih.gov/primer Help Me Understand Genetics]
* [https://academic.oup.com/jnci/article/113/12/1601/6212056 Predictive Biomarkers: Progress on the Road to Personalized Cancer Immunotherapy] Emens 2021
* [https://www.rna-seqblog.com/how-can-rna-sequencing-strengthen-cancer-diagnostics-in-precision-medicine/ How can RNA sequencing strengthen cancer diagnostics in precision medicine]


* MAPQ (5th column): MAPping Quality. It equals '''−10 log10 Pr{mapping position is wrong}''' (defined by SAM documentation), rounded to the nearest integer. A value 255 indicates that the mapping quality is not available. MAPQ is a metric that tells you how confident you can be that the read comes from the reported position. So given 1000 reads, for example, read alignments with mapping quality being 30, one of them will be wrong in average (10^(30/-10)=.001). Another example, if MAPQ=70, then the probability mapping position is wrong is 10^(70/-10)=1e-7. We can use 'samtools view -q 30 input.bam' to keep reads with MAPQ at least 30. Users should refer to the alignment program for the 'MAPQ' value it uses.  
== Cancer and gene markers ==
* AS (optional, 14th column in my case): Alignment score is a metric that tells you how similar the read is to the reference. AS increases with the number of matches and decreases with the number of mismatches and gaps (rewards and penalties for matches and mismatches depend on the scoring matrix you use)
* '''Colorectal cancer''' patients without '''KRAS mutations''' have far better outcomes with '''EGFR treatment''' than those with KRAS mutations.  
** Two '''EGFR inhibitors''', cetuximab and panitumumab are not recommended for the treatment of colorectal cancer in patients with KRAS mutations in codon 12 and 13.
* '''Breast cancer'''.
** [https://en.wikipedia.org/wiki/Trastuzumab Trastuzumab]
** [https://en.wikipedia.org/wiki/Tamoxifen Tamoxifen]


Note:
== The shocking truth about space travel ==
# '''MAPQ scores produced by the aligners typically involves the alignment score and other information.'''
[https://www.morningticker.com/2018/03/the-shocking-truth-about-space-travel/ 7 percent of DNA belonging to NASA astronaut Scott Kelly changed in the time he was aboard the International Space Station]
# You can have high AS and low MAPQ if the read aligns perfectly at multiple positions, and you can have low AS and high MAPQ if the read aligns with mismatches but still the reported position is still much more probable than any other.
 
# You probably want to filter for MAPQ, but "good" alignment may refer to AS if what you care is similarity between read and reference.
== bioSyntax: syntax highlighting for computational biology ==
# [https://sequencing.qcfail.com/articles/mapq-values-are-really-useful-but-their-implementation-is-a-mess/ MAPQ values are really useful but their implementation is a mess] by Simon Andrews
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2315-y
 
== Deep learning ==
[https://www.nature.com/articles/s41576-019-0122-6 Deep learning: new computational modelling techniques for genomics]


== gene's isoform ==
== HRD/homologous recombination deficiency 同源重组修复缺陷 ==
* [https://www.longdom.org/open-access/bioinformatics-tools-for-rnaseq-gene-and-isoform-quantification-2469-9853-1000140.pdf Bioinformatics Tools for RNA-seq Gene and Isoform Quantification] 2016. Figure 1 gives an illustration how isoform can affect the computation of RPKM.
* https://en.wikipedia.org/wiki/Homologous_recombination
* [https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-017-4002-1 Evaluation and comparison of computational tools for RNA-seq isoform quantification] BMC Genomics 2017.
** Homologous recombination proficient (HRP) cancer cells can repair DNA damage caused by chemotherapy, making them difficult to treat.
* [https://www.gettinggeneticsdone.com/2012/12/differential-isoform-expression-cuffdiff2.html Differential Isoform Expression With RNA-Seq: Are We Really There Yet?]
** drugs have been developed to target homologous recombination via c-Abl inhibition and to exploit (take advantage of) deficiencies in homologous recombination in cancer cells with BRCA mutations.
* An example of unidentified transcript-level estimates while gene-level estimation is still possible. Figure 1C in [https://f1000research.com/articles/4-1521/v2 Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences]
** One such drug is Olaparib, a PARP1 inhibitor that targets cancer cells by inhibiting base-excision repair (BER) in HR-deficient cells. However, cancer cells can become resistant to PARP1 inhibitors if they undergo deletions of mutations in BRCA2, restoring their ability to repair DNA by HR.
* https://www.genome.gov/genetics-glossary/homologous-recombination (graphical illustration). Homologous recombination is a type of genetic recombination in which nucleotide sequences are exchanged between two similar or identical molecules of DNA.


== FFPE Tissue vs Frozen Tissue ==
* BRCA1 and BRCA2 are genes that produce proteins responsible for repairing damaged DNA within cells. Mutations in these genes can lead to errors in the DNA repair process, resulting in an accumulation of mutations that can cause cancer. This '''condition''' is known as '''Homologous Recombination Deficiency (HRD)'''. [https://en.wikipedia.org/wiki/PARP_inhibitor PARP inhibitors] are a type of targeted therapy that blocks the enzyme Poly (ADP-ribose) polymerase (PARP), which helps repair DNA damage in (cancer) cells. By inhibiting PARP, these drugs prevent cancer cells from repairing their DNA, leading to cell death.
* [https://www.biochain.com/general/what-is-ffpe-tissue/ What Is FFPE Tissue And What Are Its Uses]
* [https://rna-seqblog.com/a-new-model-to-predict-survival-in-colorectal-cancer-from-rna-seq-data/ A new model to predict survival in colorectal cancer from DNA / RNA-Seq data]


= Other software =
* The '''inability to repair DNA damage''' is referred to as homologous recombination deficiency (HRD). [https://www.qiagen.com/us/applications/oncology/solid-tumor/dna-damage-response/hrd DNA damage response] from Qiagen.
== Partek ==
* Partek Flow Software http://youtu.be/-6aeQPOYuHY
* [https://youtu.be/tZ4BhhVCJfU?t=893 RNA Seq Analysis with Partek Flow]
* [https://www.youtube.com/watch?v=cj9M--9zzgI&list=PLLFT1pfBxZZj8xOCjZTFjt3EX7jqvUgDm A playlist of Single Cell Analysis with Partek Flow Bioinformatics Software]


== [http://www.hsph.harvard.edu/cli/complab/dchip/ dCHIP] ==
* FDA approved for HRD assessment: 1) [https://www.accessdata.fda.gov/cdrh_docs/pdf17/P170019S043C.pdf Foundation Medicine's FoundationOne CDx] in 2020, 2) [https://investor.myriad.com/news-releases/news-release-detail/20741/ Myriad myChoice CDx] in 2019. PS:
** '''CDx''' stands for '''Companion Diagnostic'''. They help identify patients who might benefit from specific treatments, particularly in the context of certain cancer therapies. In the case of HRD (Homologous Recombination Deficiency) assessment, these CDx tests help identify patients who might respond well to PARP inhibitors or other targeted therapies.
** In the case of HRD (Homologous Recombination Deficiency) assessment, these CDx tests help identify patients who might respond well to PARP inhibitors or other targeted therapies.


== [http://www.tm4.org/mev/ MeV] ==
* How '''HRD''' and '''PARP inhibitors''' relate:
** Cancer cells with HRD are already struggling to repair DNA damage.
** When these cells are treated with PARP inhibitors, it becomes even harder for them to repair DNA damage.
** This combination can lead to cancer cell death, a concept known as "synthetic lethality."
** In other words, PARP inhibitors (PARPi) are primarily used in patients who are HRD-positive.  


MeV v4.8 (11/18/2011) allows annotation from Bioconductor
* Role of '''CDx tests''' in '''HRD''' assessment:
** These tests analyze tumor samples for signs of HRD.
** They may look for specific gene mutations (like BRCA1/2) or broader genomic patterns indicative of HRD.
** The results help predict whether a patient's cancer is likely to respond to PARP inhibitors.


== IPA from Ingenuity ==
* Clinical implications:
Login:
** Patients who test positive for HRD are more likely to benefit from PARP inhibitors.
There are web started version https://analysis.ingenuity.com/pa and Java applet version https://analysis.ingenuity.com/pa/login/choice.jsp. We can double click the file <IpaApplication.jnlp> in my machine's download folder.
** Those without HRD might be better suited for other treatment options.


Features:
* Beyond PARP inhibitors:
* easily search the scientific literature/integrate diverse biological information.
** HRD status can also inform the use of '''platinum-based chemotherapies''' and potentially other DNA-damaging agents.
* build dynamic pathway models
* quickly analyze experimental data/Functional discovery: assign function to genes
* share research and collaborate. On the other hand, IPA is web based, so it takes time for running analyses. Once submitted analyses are done, an email will be sent to the user.


Start Here
* Cancer types:
<pre>
** This approach is particularly relevant in ovarian, breast, prostate, and pancreatic cancers, among others.
Expression data -> New core analysis -> Functions/Diseases -> Network analysis
 
                                        Canonical pathways        |
* openai
                                              |                  |
**  Poly(ADP-ribose) polymerase '''(PARP) inhibitors''' are a class of '''drugs''' that are designed to '''inhibit the activity of PARP enzymes'''. PARP enzymes are proteins that are involved in DNA repair pathways. They help to repair DNA damage and maintain the stability of the genome by adding a chemical group called poly(ADP-ribose) to other proteins.
Simple or advanced search --------------------+                  |
** PARP inhibitors work by blocking the activity of PARP enzymes, which can interfere with the ability of cells to repair damaged DNA. This can be especially useful in '''cancer cells''', which often rely on PARP enzymes to repair DNA damage and maintain genomic stability. By inhibiting PARP enzymes, PARP inhibitors can sensitizize cancer cells to chemotherapy and other treatments, making them more vulnerable to cell death.
                                              |                  |
** is there drug targeting HRP cancer patients? One approach is to target homologous recombination via c-Abl inhibition. For example, [https://pubmed.ncbi.nlm.nih.gov/34635996/ Niraparib] is a PARP inhibitor that has been shown to be effective in treating advanced ovarian cancer in both homologous recombination deficient (HRD) and homologous recombination proficient (HRP) patients.
                                              v                  |
** is there any drugs target HRD cancer patients? Yes, there are several drugs that have been developed to target HRD cancer cells. One approach is to use PARP inhibitors, which exploit deficiencies in homologous recombination in cancer cells with BRCA mutations. For example, Olaparib is a PARP1 inhibitor that has been shown to be effective in shrinking or stopping the growth of tumors from breast, ovarian and prostate cancers caused by mutations in the BRCA1 or BRCA2 genes. By inhibiting base-excision repair (BER) in HR-deficient cells, Olaparib applies the concept of synthetic lethality to specifically target cancer cells. PS: '''Examples of PARP inhibitors''' include niraparib (Zejula), olaparib (Lynparza), talazoparib (Talzenna), and rucaparib (Rubraca).
                                        My pathways, Lists <------+
** PARP1 is a ''member'' of the PARP family of proteins. PARP stands for Poly (ADP-ribose) polymerase. The [https://en.wikipedia.org/wiki/Poly_%28ADP-ribose%29_polymerase PARP] family comprises 17 members.
                                              ^
 
                                              |
* '''Loss-of-function''' genes involved in this pathway can '''sensitize''' tumors to poly(adenosine diphosphate [ADP]-ribose) polymerase (PARP) inhibitors and '''platinum-based (Pt)''' chemotherapy
Creating a custom pathway --------------------+
** Certain genes that are involved in a process called Homologous Recombination Repair (HRR) can make cancer cells more '''susceptible''' to certain treatments. Specifically, it says that when these loss-of-function genes are present, the cancer cells become more sensitive to two types of chemotherapy: PARP inhibitors and platinum-based chemotherapy.
** '''Loss-of-function''' genes are genes that have mutations that prevent them from functioning properly or at all. By disrupting the normal functioning of the HRR pathway, these loss-of-function genes can make cancer cells more sensitive to PARP inhibitors and platinum-based chemotherapy.
 
* [https://github.com/sztup/scarHRD scarHRD] package. Note for the 2 test samples, the return object is a 1x4 matrix.
** HRD-LOH/Loss of Heterozygosity
** LST/Large Scale Transitions
** Number of Telomeric Allelic Imbalances
** HRD-sum (sum of the above 3)
 
* [https://academic.oup.com/oncolo/article/27/3/167/6515681 Homologous Recombination Deficiency: Concepts, Definitions, and Assays] Stewart 2022
 
* [https://www.sciencedirect.com/science/article/pii/S0959804924007834 Harmonization of homologous recombination deficiency testing in ovarian cancer: Results from the MITO16A/MaNGO-OV2 trial] 2024
** BRCA mutation status: the BRCA status was defined positive (BRCA+) when a clinically significant mutation ('''pathogenic/likely pathogenic''') was found in BRCA genes, and negative (BRCA-) if no clinically significant mutation was found. NOTE: Pathogenicity 致病性 refers to the ability of an organism to cause disease or damage in a host.
** '''Genomic instability/GI''' score (same as '''HRD score''')
** HRD status
** Sensitivty, Specificity, Agreement, Cohen kappa are used to compare new assays/tests vs reference test (Myriad)
** RECIST response rate, PFS, OS
 
* [https://pzweuj.github.io/2021/06/10/HRD.html 同源重组修复缺陷HRD 分析]
* [https://cloud.tencent.com/developer/article/1701897 这篇只有两个Figure的10分+SCI是靠什么取胜的?]
* [https://blog.csdn.net/fanyucai1/article/details/119741040 HRD检测方法]
* [https://github.com/ucscXena/gitbookdocs/blob/master/overview-of-features/genomic-signatures.md Link] to HRD score, genome-wide DNA damage footprint. The HRD value has a range 0 to 101. Most are 0 and the rest follows an exponential distribution.
* [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8640082/ Dynamically Accumulating Homologous Recombination Deficiency Score Served as an Important Prognosis Factor in High-Grade Serous Ovarian Cancer] Su 2021
** A combined HRD score ≥42 was associated with shorter OS in 33 cancer types.
** However, in ovarian cancer, which ranked the highest HRD score among other cancers, HRD ≥42 cohort was significantly associated with longer OS.
** An HRD score of ≥42 was determined to signify HRD (HR-deficient), and a score of <42 was considered HR-proficient in clinical trials.
** The datasets including 1. signatures–HRD score and genome-wide DNA damage footprint; 2. phenotype-curated clinical data; and 3. gene expression RNAseq-TOIL RSEM TPM were downloaded from https://xenabrowser.net/.
* [https://www.nature.com/articles/s41598-021-03432-3 Identification of molecular subtypes and prognostic signature for hepatocellular carcinoma based on genes associated with homologous recombination deficiency] Lin 2021.
** the combat function of R software package SVA was used for batch effect removal.
* https://xenabrowser.net/datapages/ has one set called "TCGA Pan-Cancer (PANCAN) (41 datasets)" -> HRD score, genome-wide DNA damage footprint (n=10,647) Pan-Cancer Atlas Hub.
* https://github.com/GerkeLab/TCGAhrd  where HDR can be downloaded from https://gdc.cancer.gov/about-data/publications/PanCan-DDR-2018. Choose 'Zip file with TSV files of DDR Data Resources'. Pay attention to "DDRscores.tsv" and "Scores.tsv", "Samples.tsv".
<ul>
<li>[https://github.com/GerkeLab/TCGAhrd Homologous recombination deficiency in TCGA PanCancer Atlas]
<pre>
> load("clinical_and_hrd.RData")
> dim(full_dat)
[1] 9105  792
> full_dat[1:5, c("HRD_Score", "HRD_LOH", "HRD_LST", "HRD_TAI")]
  HRD_Score HRD_LOH HRD_LST HRD_TAI
1        7      2      2      3
2        9      3      2      4
3        0      0      0      0
4        8      4      2      2
5        5      1      1      3
> summary( full_dat[1:5, c("HRD_Score", "HRD_LOH", "HRD_LST", "HRD_TAI")])
  HRD_Score      HRD_LOH    HRD_LST      HRD_TAI
Min.  :0.0  Min.  :0  Min.  :0.0  Min.  :0.0
1st Qu.:5.0  1st Qu.:1  1st Qu.:1.0  1st Qu.:2.0
Median :7.0  Median :2  Median :2.0  Median :3.0
Mean  :5.8  Mean  :2  Mean  :1.4  Mean  :2.4
3rd Qu.:8.0  3rd Qu.:3  3rd Qu.:2.0  3rd Qu.:3.0
Max.  :9.0  Max.  :4  Max.  :2.0  Max.  :4.0
 
> load("DDRscores.RData")
> ls()
[1] "dat"      "full_dat"
> dim(dat)
[1] 9125  46
> colnames(dat)
[1] "patient_id"            "acronym"                "mutLoad_silent"
[4] "mutLoad_nonsilent"      "mutSig1"                "mutSig2"
[7] "mutSig3"                "mutSig4"                "mutSig5"
[10] "mutSig6"                "mutSig7"                "mutSig8"
[13] "mutSig9"                "mutSig10"              "mutSig11"
[16] "mutSig12"              "mutSig13"              "mutSig14"
[19] "mutSig15"              "mutSig16"              "mutSig17"
[22] "mutSig18"              "mutSig19"              "mutSig20"
[25] "mutSig21"              "CNA_n_segs"            "CNA_frac_altered"
[28] "CNA_n_focal_amp_del"    "aneuploidy_score"      "aneuploidy_score_prime"
[31] "LOH_n_seg"              "LOH_frac_altered"      "purity"
[34] "ploidy"                "genome_doublings"      "subclonal_frac"
[37] "HRD_TAI"                "HRD_LST"                "HRD_LOH"
[40] "HRD_Score"              "eCARD"                  "PARPi7"
[43] "PARPi7_bin"            "RPS"                    "tp53_score"
[46] "rppa_ddr_score"
</pre>
</pre>
<li>[https://www.frontiersin.org/articles/10.3389/fonc.2021.746571/full#h13 HRD status is highly '''correlated''' with platinum chemotherapy sensitivity in patients with high-grade serous ovarian cancer (HGSOC)] 2022. Findings showed that the HRD score of platinum treatment-sensitive patients was slightly higher than that of Pt-resistant patients. Analysis showed that [https://ecancer.org/en/news/23005-hrd-detection-predicts-sensitivity-to-platinum-based-chemotherapy-for-ovarian-cancer-patients-in-china patients with positive HRD status had a significantly longer progression-free survival (PFS) compared to those with negative HRD status].
* [https://ovarianresearch.biomedcentral.com/articles/10.1186/s13048-019-0511-7 Effect of BRCA mutational status on survival outcome in advanced-stage high-grade serous ovarian cancer] 2019. The median PFS was 22.9 months for the BRCA mutation group compared to 16.9 months for the wild-type BRCA group. 6 months was used as a cutoff.
* [https://www.healthday.com/health-news/cancer/ovarian-cancer-prognosis-may-depend-on-gene-mutations-651331.html Ovarian Cancer Prognosis May Depend on Gene Mutations]. Five-year survival rates were 61 percent for those with the BRCA2 mutation, 46 percent for those with the BRCA1 mutation and 36 percent for those with neither mutation, the investigators found.
* [https://ovarianresearch.biomedcentral.com/articles/10.1186/s13048-023-01129-x Homologous recombination deficiency status predicts response to platinum-based chemotherapy in Chinese patients with high-grade serous ovarian carcinoma] 2023.
* [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10232447/ HRD effects on first-line adjuvant chemotherapy and PARPi maintenance therapy in Chinese ovarian cancer patients] 2023


Resource:
<li>[https://www.nature.com/articles/s41467-020-19406-4 Pan-cancer landscape of homologous recombination deficiency] 2020
* http://bioinformatics.mdanderson.org/MicroarrayCourse/Lectures09/Pathway%20Analysis.pdf
 
* http://libguides.mit.edu/content.php?pid=14149&sid=843471
<li>[https://www.medicalnewstoday.com/articles/hrd-positive-ovarian-cancer What to know about HRD testing for ovarian cancer]
* http://people.mbi.ohio-state.edu/baguda/PathwayAnalysis/
 
* IPA 5.5 manual http://people.mbi.ohio-state.edu/baguda/PathwayAnalysis/ipa_help_manual_5.5_v1.pdf
<li>[https://www.azprecisionmed.com/tumor-type/ovarian-cancer/hrd-testing.html HRD in Ovarian Cancer]
* [http://ingenuity.force.com/ipa Help and supports]
 
<li>SAP for [https://classic.clinicaltrials.gov/ProvidedDocs/44/NCT01891344/SAP_001.pdf from Clovis Oncology] & Rucaparib (a PARP inhibitor)
 
<li>gLOH vs LOH: The gLOH score and the LOH score are two different measures of Homologous Recombination Deficiency (HRD) in tumors. The gLOH score measures genomic loss of heterozygosity (gLOH) while the LOH score measures loss of heterozygosity (LOH) in a specific region or gene.
 
<li>[https://www.medicalnewstoday.com/articles/hrd-positive-ovarian-cancer What to know about HRD testing for ovarian cancer]
 
<li>Labs:
* ACTHRD from [https://www.actgenomics.com/patients_product.php?id=5 ACT Genomics 行動基因]. ACTHRD™ detects HRD status by LOH score and 24 HRR-related genes to evaluate whether a tumor is suitable for PARP inhibitors.
* AmoyDx. [https://pubmed.ncbi.nlm.nih.gov/36136896/ In-house testing for homologous recombination repair deficiency (HRD) testing in ovarian carcinoma: a feasibility study comparing AmoyDx HRD Focus panel with Myriad myChoiceCDx assay]
* [https://bionano.com/hrd-testing/ Bionano]
* [https://www.webull.com/news/25116275 Burning Rock]宣佈在中國獲得MyChoice®腫瘤檢測的許可
* [https://info.foundationmedicine.com/hubfs/FMI%20Labels/FoundationOne_CDx_Label_Technical_Info.pdf FoundationMedicine (?FMI) technical information]. ''Positive homologous recombination deficiency (HRD) status (F1CDx HRD defined as tBRCA-positive and/or LOH high) in ovarian cancer patients is associated with improved progression-free survival (PFS) from Rubraca (rucaparib) maintenance therapy in accordance with the Rubraca product label. '' [https://www.accessdata.fda.gov/cdrh_docs/pdf17/P170019S006C.pdf FDA doc]. [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8926248/ Clinical and analytical validation of FoundationOne®CDx, a comprehensive genomic profiling assay for solid tumors] 2022.
* [https://support-docs.illumina.com/SW/DRAGEN_Analysis_Workflows/Content/SW/Informatics/APP/HRD_appT500ctDNAlocal.htm Illumina]
* [https://myriad.com/genetic-tests/mychoicecdx-tumor-test/ Myriad]
* [https://pillarbiosci.com/news/xing-genomic-services-receives-nata-accreditation-for-pillar-biosciences-hrd-gene-panel-enabling-cost-effective-parpi-response-prediction/ Pillar Biosciences]
* [https://www.sophiagenetics.com/press-releases/sophia-genetics-launches-new-deep-learning-capabilities-to-support-the-detection-of-homologous-recombination-deficiencies/ Sophia Genetics]
* Tempus [https://www.tempus.com/oncology/algorithmic-tests/ AI-DRIVEN HRD TEST]
* Thermo fisher scientific [https://assets.thermofisher.com/TFS-Assets/CSD/Reference-Materials/hrd-biomarker-guide.pdf Everything you need to know about homologous recombination repair (HRR) and homologous recombination deficiency (HRD) testing]
</ul>
 
== Computational Pathology ==
* [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6852275/ Computational pathology definitions, best practices, and recommendations for regulatory guidance: a white paper from the Digital Pathology Association] 2019
* [https://link.springer.com/referenceworkentry/10.1007/978-3-030-80962-1_334-1 Challenges in Computational Pathology of Biomarker-Driven Predictive and Prognostic Immunotherapy]
 
== Bi-allelic, monoallelic ==
[https://www.nature.com/scitable/content/bi-allelic-and-monoallelic-expression-8816761/ Bi-allelic and monoallelic expression]. In most cases, both alleles (the two chromosomal copies) are transcribed; this is known as bi-allelic expression (left). However, a minority of genes show monoallelic expression (right). In these cases, only one allele of a gene is expressed (right).
 
== SOMAscan assay (proteomic) ==
<ul>
<li>https://somalogic.com/somascan-discovery/, https://somalogic.com/somascan-platform/, https://somalogic.com/user-manuals/
* [https://somalogic.com/wp-content/uploads/2022/08/SL00000572_Rev4_2022-01_SomaScan-Assay-v4.1.pdf SomaScan Assay v4.1] 7k
* [https://github.com/SomaLogic/SomaDataIO SomaDataIO] R package (currently 6.0.0), [https://somalogic.github.io/SomaDataIO/ Documentation including Vignettes].
:<syntaxhighlight lang='r'>
f <- "SS-1234567_v4.1_Serum.hybNorm.medNormInt.plateScale.calibration.anmlQC.qcCheck.anmlSMP.adat"
my_adat <- read_adat(f)
eset <- adat2eSet(my_adat)
 
exprs(eset) |> dim() # 7596 x ns
 
pData(phenoData(eset)) # ns x 33
table(pData(phenoData(eset))$SampleType)
 
pData(featureData(eset)) # 7596 x 19
j2 <- pData(featureData(eset))$Organism == "Human" &
    (pData(featureData(eset))$Type %in% c("Protein", "Non-Human")) 
sum(j2) # 7289
</syntaxhighlight>
* [https://somalogic.github.io/SomaScan.db/ SomaScan.db] R package. v4.0 is 5K.
* [https://investors.somalogic.com/news-releases/news-release-details/somalogic-announces-new-somascanr-11k-platform SomaScan 11K Assay v5.0]
 
<li>[https://pubmed.ncbi.nlm.nih.gov/27146037/ readat: An R package for reading and working with SomaLogic ADAT files]
* https://bitbucket.org/graumannlabtools/readat/src/master/. The R package is not in Bioconductor.
 
<li>[https://rdrr.io/github/andreagrioni/ToolViz/ ToolViz] package.
<li>[https://www.ncbi.nlm.nih.gov/gds/?term=somascan NCBI-GEO], [https://www.ncbi.nlm.nih.gov/geo/browse/?view=platforms&search=somascan&display=20 All list]
 
<li>[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9561184/ Assessment of variability in the plasma 7k SomaScan proteomics assay] 2022
</ul>
 
== Scandal ==
[https://www.techbang.com/posts/98333-alzheimers-papers-are-suspected-of-being-fraudulent-setting 阿茲海默症關鍵論文被揭發疑似造假,16年來全球醫學專家可能都被呼弄] & [https://news.ltn.com.tw/news/world/breakingnews/4000907 阿茲海默症關鍵論文疑造假 誤導外界16年]
 
= Terms =
== RNA vs DNA ==
* [https://medcitynews.com/2020/09/why-rna-is-a-better-measure-of-a-patients-current-health-than-dna/ Why RNA is a better measure of a patient’s current health than DNA]
* [http://www.hkcna.hk/content/2020/1216/868269.shtml 英美接種疫苗,陰謀論隨之盛行]. 核糖核酸=RNA. 脱氧核糖核酸=DNA. 輝瑞公司開發的新冠疫苗,是使用mRNA疫苗原理,即抽取病毒內部分核糖核酸編碼蛋白(或者稱信使核糖核酸)制成疫苗。
** [https://vitals.lifehacker.com/how-mrna-vaccines-work-1845895792 How mRNA Vaccines Work]
** [https://www.acsh.org/news/2020/10/21/how-pfizers-rna-vaccine-works-15104 How Pfizer's RNA Vaccine Works]
** Pfizer’s Covid Vaccine: 11 Things You Need to Know
** [https://blog.ephorie.de/covid-19-vaccine-95-effective-it-doesnt-mean-what-you-think-it-means COVID-19 vaccine “95% effective”: It doesn’t mean what you think it means!]
** [https://www.courthousenews.com/vaccine-technology-how-mrna-changed-the-fight-against-covid-19/ Vaccine Technology: How MRNA Changed the Fight Against Covid-19]
 
== 基因结构 ==
https://zhuanlan.zhihu.com/p/49601643
 
== Pseudogene ==
https://www.genome.gov/genetics-glossary/Pseudogene. An example: [https://www.genecards.org/cgi-bin/carddisp.pl?gene=OR7E47P OR7E47P] with alias [https://genome.weizmann.ac.il/horde/card/index/symbol:OR7E47P bpl 41-16 or bpl41-16].
 
== PCR ==
[https://unclegene6666.pixnet.net/blog/post/302562043 什麼是PCR? 聚合酶鏈鎖反應?] 基因叔叔
 
== Epidemiology ==
[https://www.bmj.com/about-bmj/resources-readers/publications/epidemiology-uninitiated Epidemiology for the uninitiated]
 
== Serum vs plasma ==
[https://pmc.ncbi.nlm.nih.gov/articles/PMC3409228/ Comparing the MicroRNA Spectrum between Serum and Plasma]
 
== Cell lines ==
* cell line (體外). tumor samples (體內)
* [https://www.nature.com/articles/nature14397 A resource for cell line authentication, annotation and quality control]
* [https://www.biologydiscussion.com/cell/cell-lines/cell-lines-types-nomenclature-selection-and-maintenance-with-statistics/10517 Cell Lines: Types, Nomenclature, Selection and Maintenance (With Statistics)]
* [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5001206/ Comprehensive comparison of molecular portraits between cell lines and tumors in breast cancer] Jiang 2016
* [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3715866/ Evaluating cell lines as tumour models by comparison of genomic profiles] Domcke 2013
* Google: tumor cell line vs tumor samples
 
==  in vivo, in vitro, and in situ ==
=== In silico 電腦模擬 (in silicon, s=simulation) ===
* https://en.wikipedia.org/wiki/In_silico An in silico experiment is one performed on computer or via computer simulation.
* The main difference between '''in silico''' gene expression analysis and '''experimental''' gene expression analysis is the method used to study the patterns and levels of gene expression.
** In silico gene expression analysis involves the use of computational tools and algorithms to analyze large datasets of gene expression data obtained from techniques such as microarrays, RNA sequencing, or single-cell RNA sequencing. This analysis can include identifying differentially expressed genes between samples, clustering genes with similar expression patterns, and predicting the functional roles of genes based on their expression profiles.
** On the other hand, experimental gene expression analysis involves directly measuring the levels and patterns of gene expression using laboratory techniques. These techniques can include real-time polymerase chain reaction (PCR), northern blotting, western blotting, and immunohistochemistry, among others. These experimental techniques allow researchers to directly measure the levels of specific RNA or protein molecules in biological samples.
** While in silico gene expression analysis is a rapid and cost-effective way to analyze large datasets of gene expression data, it relies on the accuracy and completeness of the data being analyzed. Experimental gene expression analysis provides a more direct and accurate view of gene expression but can be more time-consuming and expensive. In practice, both in silico and experimental gene expression analysis are valuable tools that can be used to complement each other in the study of gene expression and its role in various biological processes and diseases.
* [https://molecular-cancer.biomedcentral.com/articles/10.1186/1476-4598-6-50 In silico gene expression analysis--an overview] Murray 2007
* [https://www.future-science.com/doi/10.2144/btn-2018-0179 A simple in silico approach to generate gene-expression profiles from subsets of cancer genomics data] 2019
** TCGA from cbioportal was used
** Details steps including screenshots are available at [https://www.future-science.com/doi/suppl/10.2144/btn-2018-0179 Supplementary material]
 
=== In situ 原處 (介於in vivo與in vitro之間) ===
* https://en.wikipedia.org/wiki/In_situ 意義大致介於in vivo與in vitro之間。
* Something that’s performed in situ means that it’s observed in its natural context, but '''outside of a living organism'''. In vivo is Latin for “within the living.” It refers to work that’s performed in a whole, living organism .
* A good example of this is a technique called '''in situ hybridization (ISH)'''. ISH can be used to look for a specific '''nucleic acid''' (DNA or RNA) within something like a tissue sample. Specialized probes are used to bind to a specific nucleic acid sequence that the researcher is looking to find. These probes are tagged with things like radioactivity or fluorescence. This allows the researcher to see where the nucleic acid is located within the tissue sample. ISH allows the researcher to observe where a nucleic acid is located within its natural context, yet outside of a living organism. Examples are microarray experiments.
 
=== in vivo 活体内 ===
* IN VIVO describes a medical experiment or a test that is performed on a '''living organism''', e.g. a human being or a laboratory animal.
* [https://www.promocell.com/in-the-lab/human-primary-cells-and-immortal-cell-lines/ Human primary cells and immortal cell lines: differences and advantages]
* [https://pediaa.com/what-is-the-difference-between-primary-cell-culture-and-cell-line/ What is the Difference Between Primary Cell Culture and Cell Line]
 
'''Syngenic'''
* https://en.wikipedia.org/wiki/Syngenic
* [https://www.crownbio.com/model-systems/in-vivo Syngeneic models]
 
''Syngeneic tumor models'' are experimental models used in cancer research that use '''genetically identical animals''' to study the growth and spread of cancer cells. In these models, a malignant tumor is induced in one animal and then transplanted into another animal of the same genetic background. This allows researchers to study the interactions between the host immune system and the cancer cells, as well as the response of the tumor to various treatments.
 
''Syngeneic tumor models'' are often used in combination with other experimental models, such as '''xenograft models''' (where the cancer cells are transplanted into a genetically different animal) or '''cell line models''' (where the cancer cells are grown in a laboratory). By using a combination of these models, researchers can gain a more complete understanding of the biology of cancer and develop new treatments for cancer patients.
 
The ''syngeneic model'' is an important tool for studying the role of the immune system in cancer, as the genetically identical animals allow researchers to control for genetic differences that might impact the immune response. Additionally, because the host immune system in these models is functional and can mount a response against the transplanted cancer cells, the syngeneic model provides a more realistic representation of the host-tumor interaction than other models that rely on immunodeficient animals.
 
=== in vitro 试管内/体外 ===
* https://en.wikipedia.org/wiki/In_vitro
* https://en.wikipedia.org/wiki/In_silico
* https://en.wikipedia.org/wiki/RNA-Seq
 
== RUO: research use only ==
'''RUO''' stands for "Research Use Only". In the context of clinical trials and laboratory research, it refers to in vitro diagnostic products (IVDs) that are intended to be used in non-clinical studies, including to gather data for submission as required by regulatory authorities³. These products are not intended for use in diagnostic procedures. They are often used by medical laboratories and other institutions for research purposes. However, if these products are used for purposes other than research, it could have legal implications. It's important to note that RUO products are not subject to the same regulatory controls as in-vitro diagnostic medical devices (CE-IVDs) that must comply with the applicable legal requirements.
 
* [https://www.fda.gov/regulatory-information/search-fda-guidance-documents/distribution-in-vitro-diagnostic-products-labeled-research-use-only-or-investigational-use-only Distribution of In Vitro Diagnostic Products Labeled for Research Use Only or Investigational Use Only]
* [https://blog.microbiologics.com/ivd-in-vitro-diagnostic-versus-ruo-research-use-only/ In Vitro Diagnostic Use (IVD) versus Research Use Only (RUO) in the Clinical Laboratory]
 
== RNA sequencing 101 ==
Web
* [https://www.edx.org/course/introduction-to-biology-the-secret-of-life-24 Introduction to Biology - The Secret of Life] from edX. It's one of the top 100 best [https://www.classcentral.com/collection/top-free-online-courses free online courses] posted by ClassCentral.
* [http://ctehr.tamu.edu/media/864063/jason-seq-pres.pdf Introduction to RNA-Seq] including biology overview (DNA, Alternative splcing, mRNA structure, human genome) and sequencing technology.
* [https://youtu.be/7BLS_YY9HeM Introduction to RNA-Seq for Researchers] (youtube)
* [http://www.chem.agilent.com/Library/eseminars/Public/RNA%20Sequencing%20101.pdf RNA Sequencing 101] by Agilent Technologies. Includes the definition of sequencing depth (number of reads per sample) and coverage (number of reads/locus).
** [https://www.ecseq.com/support/ngs/what-is-a-good-sequencing-depth-for-bulk-rna-seq What is a good sequencing depth for bulk RNA-Seq?] In general 5 M mapped reads is a good bare minimum for a differential gene expression (DGE) analysis in human. In many cases 5 M – 15 M mapped reads are sufficient. Many published human RNA-Seq experiments have been sequenced with a sequencing depth between 20 M - 50 M reads per sample.
** [https://www.biostars.org/p/139006/ How to count fastq reads] ''echo $(zcat yourfile.fastq.gz | wc -l)/4 | bc''
* Where do we get reads(A,C,T,G) from sample RNA? See page 12 of this [https://www.biostat.wisc.edu/bmi776/lectures/rnaseq.pdf pdf] from Colin Dewey in U. Wisc.
* Quantification of RNA-Seq data (see the above pdf)
* Convert read counts into expression: RPKM (see the above pdf)
* RPKM and FPKM ([https://docs.google.com/file/d/0B23nQZpa5ce0ak9jNEdlMEVqemc/edit Data analysis of RNA-seq from new generation sequencing] by 張庭毓) RNA-Seq資料分析研討會與實作課程 / RNA Seq定序 / 次世代定序(NGS) / 高通量基因定序 分析.
* [http://yourgene.pixnet.net/blog/post/66237799 First vs Second] generation sequence.
* [http://sfg.stanford.edu/SFG.pdf The Simple Fool’s Guide to Population Genomics via RNA­Seq]: An Introduction to High­Throughput Sequencing Data Analysis. This covers QC, De novo assembly, BLAST, mapping reads to reference sequences, gene expression analysis and variant (SNP) detection.
* [http://nihlibrary.nih.gov/Services/Bioinformatics/Documents/Lipsett100928talk_web.pdf An Introduction to Bioinformatics Resources and their Practical Applications] from [http://nihlibrary.nih.gov/Services/Bioinformatics/Pages/default.aspx NIH library Bioinformatics Support Program].
* [http://www.rnaseqforthenextgeneration.org/resources/index.html Teaching material] from rnaseqforthenextgeneration.org which includes Designing RNA-Seq experiments, Processing RNA-Seq data, and Downstream analyses with RNA-Seq data.
 
== Books ==
* [http://www.amazon.com/RNA-seq-Data-Analysis-Mathematical-Computational/dp/1466595000 RNA-seq Data Analysis: A Practical Approach]. The pdf version is available on slideshare.net.
* [http://www.amazon.com/Statistical-Generation-Sequencing-Frontiers-Probability/dp/3319072110/ref=pd_bxgy_b_img_y Statistical Analysis of Next Generation Sequencing Data]
* [https://www.huber.embl.de/msmb/ Modern Statistics for Modern Biology] (free, see [[Statistics#Books_2|Statistics books]]) by Holmes and Huber. Plots are based on ggplot2.
* [https://github.com/harvardinformatics/learning-bioinformatics-at-home Learning Bioinformatics At Home] - some resources gathered by the Harvard Informatics group.
** Install all required packages using [https://www.huber.embl.de/msmb/ the R script] gives me errors. It would be great if there is a Docker image. Another solution is to run install.packages(pkgsToInstall, Ncpus=4) manually.
* [https://compgenomr.github.io/book/?s=09 Computational Genomics with R] by Altuna Akalin
 
== strand-specific vs non-strand specific experiment ==
* http://seqanswers.com/forums/showthread.php?t=28025. According to this message and the [http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0126545 article] (under the paragraph of '''Read counting''') from PLOS, ''most of the RNA-seq protocols that are used nowadays are not strand-specific''.
* http://biology.stackexchange.com/questions/1958/difference-between-strand-specific-and-not-strand-specific-rna-seq-data
* https://www.biostars.org/p/61625/ how to find if this public rnaseq data are prepared by strand-specific assay?
* https://www.biostars.org/p/62747/ Discussion of using IGV to view strand-specific coverage. See also the similar posts on the right hand side.
* https://www.biostars.org/p/44319/ How To Find Stranded Rna-Seq Experiments Data. The text ''dUTP 2nd strand marking'' includes a link to stranded rna-seq data.
* forward (+)/ reverse(-) strand in GAlignments objects ([http://www.bioconductor.org/packages/release/bioc/manuals/GenomicAlignments/man/GenomicAlignments.pdf p68 of the pdf manual] and  [https://samtools.github.io/hts-specs/SAMv1.pdf page 7 of sam format specification].
 
Understand this info is necessary when we want to use summarizeOverlaps() function (GenomicAlignments) or htseq-count python program to get count data.
 
[https://www.biostars.org/p/98756/ This post] mentioned to use [http://rseqc.sourceforge.net/ infer_experiment.py script] to check whether the rna-seq run is stranded or not.
 
The rna-seq experiment used in [http://www.bioconductor.org/help/workflows/rnaseqGene/ this tutorial] is not stranded-specific.
 
== FASTQ ==
* [http://en.wikipedia.org/wiki/FASTQ_format FASTQ=FASTA + Qual]. FASTQ format is a text-based format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores.
=== Phred quality score ===
q = -10log10(p) where p = <span style="color: red">error</span> probability for the base.
{| class="wikitable"
! q
! <span style="color: red">error</span> probability
! base call accuracy
|-
| 10
| 0.1
| 90%
|-
| 13
| 0.05
| 95%
|-
| 20
| 0.01
| 99%
|-
| 30
| 0.001
| 99.9%
|-
| 40
| 0.0001
| 99.99%
|-
| 50
| 0.00001
| 99.999%
|}
 
== FASTA ==
fasta/fa files can be used as reference genome in IGV. But we cannot load these files in order to view them.
 
=== Download sequence files ===
* ftp://ftp.ncbi.nih.gov/genomes/H_sapiens/RNA/ Assembled genome sequence and annotation data for RefSeq genome assemblies
* ftp://ftp.ncbi.nlm.nih.gov/refseq/H_sapiens/
 
=== Compute the sequence length of a FASTA file ===
https://stackoverflow.com/questions/23992646/sequence-length-of-fasta-file
<syntaxhighlight lang='bash'>
awk '/^>/ {if (seqlen){print seqlen}; print ;seqlen=0;next; } { seqlen += length($0)}END{print seqlen}' file.fa
 
head -2 file.fa | \
    awk '/^>/ {if (seqlen){print seqlen}; print ;seqlen=0;next; } { seqlen += length($0)}END{print seqlen}'  | \
    tail -1
</syntaxhighlight>
 
== FASTA <=> FASTQ conversion ==
According to [https://www.quora.com/Bioinformatics-What-is-the-difference-between-fasta-fastq-and-sam-files this post],
 
* FastA are text files containing multiple DNA* seqs each with some text, some part of the text might be a name.
* FastQ files are like  fasta, but they also have quality scores for each base of each seq, making them appropriate for reads from an Illumina machine (or other brands)
 
=== Convert FASTA to FASTQ without quality scores ===
 
[https://www.biostars.org/p/99886/ Biostars]. For example, the [https://github.com/lh3/bioawk bioawk] by lh3 (Heng Li) worked.
 
=== Convert FASTA to FASTQ with quality score file ===
See the links on the above post.
 
=== Convert FASTQ to FASTA using Seqtk ===
Use the [https://github.com/lh3/seqtk Seqtk] program; see [https://www.biostars.org/p/85929/ this post].
 
The '''Seqtk''' program by lh3 can be used to sample reads from a fastq file including paired-end; see [https://www.biostars.org/p/69348/ this post].
 
== RPKM (Mortazavi et al. 2008) and cpm (counts per million) ==
Reads per Kilobase of Exon per Million of Mapped reads.
 
* RPKMs can only be calculated for those genes for which the '''gene length''' and '''GC content''' information is available; see the vignette of [https://www.bioconductor.org/packages/release/bioc/vignettes/GSVA/inst/doc/GSVA.pdf#page=17  GSVA]
* rpkm function in [https://support.bioconductor.org/p/59317/ edgeR] package.
* RPKM function in [https://support.bioconductor.org/p/50413/ easyRNASeq] package.
* TMM > cpm > log2 transformation on the paper [https://bmccancer.biomedcentral.com/track/pdf/10.1186/s12885-018-4546-8#page=3 Gene expression profiling of 1200 pancreatic ductal adenocarcinoma reveals novel subtypes]
* [https://en.wikipedia.org/wiki/RNA-Seq#Gene_expression_quantification Gene expression quantification] from RNA-Seq wikipedia page
** Sequencing depth/coverage: the total number of reads generated in a single experiment is typically normalized by converting counts to fragments, reads, or counts per million mapped reads ('''FPM, RPM, or CPM''').
** Gene length: '''FPKM, TPM'''. Longer genes will have more fragments/reads/counts than shorter genes if transcript expression is the same. This is adjusted by dividing the FPM by the length of a gene, resulting in the metric fragments per kilobase of transcript per million mapped reads (FPKM). When looking at groups of genes across samples, FPKM is converted to transcripts per million (TPM) by dividing each FPKM by the sum of FPKMs within a sample.
* [https://bioinformatics.stackexchange.com/a/2299 Difference between CPM and TPM and which one for downstream analysis?]. '''CPM''' is basically depth-normalized counts whereas '''TPM''' is length normalized (and then normalized by the length-normalized values of the other genes).
* [http://robpatro.com/blog/?p=235 The RNA-seq abundance zoo]. The counts per million ('''CPM''') metric takes the raw (or estimated) counts, and performs the first type of normalization I mention in the previous section.  That is, it normalized the count by the library size, and then multiplies it by a million (to avoid scary small numbers).
* See also the [[ScRNA#Normalization|log(CPM)]] implemented in Seurat::NormalizeData() for scRNA-seq data.
 
Idea
* The more we sequence, the more reads we expect from each gene. '''This is the most relevant correction of this method.'''
* Longer transcript are expected to generate more reads. '''The latter is only relevant for comparisons among different genes which we rarely perform!'''. As such, the DESeq2 only creates a size factor for each library and normalize the counts by dividing counts by a size factor (scalar) for each library. Note that: H0: mu1=mu2 is equivalent to H0: c*mu1=c*mu2 where c is gene length.
 
Calculation
# Count up the total reads in a sample and divide that number by 1,000,000 – this is our “per million” scaling factor.
# Divide the read counts by the “per million” scaling factor. This normalizes for sequencing depth, giving you reads per million (RPM)
# Divide the RPM values by the length of the gene, in kilobases. This gives you RPKM.
 
Formula
<pre>
RPKM = (10^9 * C)/(N * L), with
 
C = Number of reads mapped to a gene
N = Total mapped reads in the experiment
L = gene length in base-pairs for a gene
</pre>
 
<syntaxhighlight lang="rsplus">
source("http://www.bioconductor.org/biocLite.R")
biocLite("edgeR")
library(edgeR)
 
set.seed(1234)
y <- matrix(rnbinom(20,size=1,mu=10),5,4)
    [,1] [,2] [,3] [,4]
[1,]    0    0    5    0
[2,]    6    2    7    3
[3,]    5  13    7    2
[4,]    3    3    9  11
[5,]    1    2    1  15
 
d <- DGEList(counts=y, lib.size=1001:1004)
# Note that lib.size is optional
# By default, lib.size = colSums(counts)
cpm(d) # counts per million
  Sample1  Sample2  Sample3  Sample4
1    0.000    0.000 4985.045    0.000
2 5994.006  1996.008 6979.063  2988.048
3 4995.005 12974.052 6979.063  1992.032
4 2997.003  2994.012 8973.081 10956.175
5  999.001  1996.008  997.009 14940.239
> cpm(d,log=TRUE)
    Sample1  Sample2  Sample3  Sample4
1  7.961463  7.961463 12.35309  7.961463
2 12.607393 11.132027 12.81875 11.659911
3 12.355838 13.690089 12.81875 11.129470
4 11.663897 11.662567 13.17022 13.451207
5 10.285119 11.132027 10.28282 13.890078
 
d$genes$Length <- c(1000,2000,500,1500,3000)
rpkm(d)
    Sample1  Sample2    Sample3  Sample4
1    0.0000    0.000  4985.0449    0.000
2 2997.0030  998.004  3489.5314 1494.024
3 9990.0100 25948.104 13958.1256 3984.064
4 1998.0020  1996.008  5982.0538 7304.117
5  333.0003  665.336  332.3363 4980.080
 
> cpm
function (x, ...)
UseMethod("cpm")
<environment: namespace:edgeR>
> showMethods("cpm")
 
Function "cpm":
<not an S4 generic function>
> cpm.default
function (x, lib.size = NULL, log = FALSE, prior.count = 0.25,
    ...)
{
    x <- as.matrix(x)
    if (is.null(lib.size))
        lib.size <- colSums(x)
    if (log) {
        prior.count.scaled <- lib.size/mean(lib.size) * prior.count
        lib.size <- lib.size + 2 * prior.count.scaled
    }
    lib.size <- 1e-06 * lib.size
    if (log)
        log2(t((t(x) + prior.count.scaled)/lib.size))
    else t(t(x)/lib.size)
}
<environment: namespace:edgeR>
> rpkm.default
function (x, gene.length, lib.size = NULL, log = FALSE, prior.count = 0.25,
    ...)
{
    y <- cpm.default(x = x, lib.size = lib.size, log = log, prior.count = prior.count)
    gene.length.kb <- gene.length/1000
    if (log)
        y - log2(gene.length.kb)
    else y/gene.length.kb
}
<environment: namespace:edgeR>
</syntaxhighlight>
 
Here for example the 1st sample and the 2nd gene, its rpkm value is calculated as
<syntaxhighlight lang="rsplus">
# step 1:
6/(1.0e-6 *1001) = 5994.006    # cpm, compute column-wise
# step 2:
5994.006/ (2000/1.0e3) = 2997.003 # rpkm, compute row-wise
 
# Another way
# step 1 (RPK)
6/ (2000/1.0e3) = 3
# step 2 (RPKM)
3/ (1.0e-6 * 1001) = 2997.003
</syntaxhighlight>
 
Another example. [https://github.com/oxwang/fda_scRNA-seq/blob/master/3_Normalization/Code/HCC1395/10X_LLU.R#L52 source code] of calc_cpm().
<pre>
library(edgeR)
set.seed(1234)
y <- matrix(rnbinom(20,size=1,mu=10),5,4)
cpm(y)
#          [,1]  [,2]      [,3]      [,4]
#[1,]      0.00      0 172413.79      0.00
#[2,] 400000.00 100000 241379.31  96774.19
#[3,] 333333.33 650000 241379.31  64516.13
#[4,] 200000.00 150000 310344.83 354838.71
#[5,]  66666.67 100000  34482.76 483870.97
 
calc_cpm <- function (expr_mat) {
    norm_factor <- colSums(expr_mat)
    return(t(t(expr_mat)/norm_factor) * 10^6)
    # Fix a bug in the original code
    # Not affect silhouette()
}
 
calc_cpm(y)
#          [,1]  [,2]      [,3]      [,4]
#[1,]      0.00      0 172413.79      0.00
#[2,] 400000.00 100000 241379.31  96774.19
#[3,] 333333.33 650000 241379.31  64516.13
#[4,] 200000.00 150000 310344.83 354838.71
#[5,]  66666.67 100000  34482.76 483870.97
</pre>
 
=== Critics ===
* [http://faculty.ucr.edu/~tgirke/HTML_Presentations/Manuals/Workshop_Dec_12_16_2013/Rrnaseq/Rrnaseq.pdf RPKM/FPKM is not suitable for statistical testing] (p11):
 
''Consider the following example: in two libraries, each with one million reads, gene X may have 10 reads for treatment A and 5 reads for treatment B, while it is 100x as many after sequencing 100 millions reads from each library. In the latter case we can be much more confident that there is a true difference between the two treatments than in the first one. However, the RPKM values would be the same for both scenarios. Thus, RPKM/FPKM are useful for reporting expression values, but not for statistical testing!''
 
* [http://blog.nextgenetics.net/?e=51 RPKM measure is inconsistent among samples]
 
=== CPM vs TPM ===
Both has the property that the sumof reads is 1 million(10^6). But TPM includes gene length normalization (TPM accounts for variations in gene length (done first) and sequencing depth (done second)). So if want to find DE genes between samples, it is common to use the TPM normalization method.
 
=== (another critic) Union Exon Based Approach ===
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0141910
 
In general, the methods for gene quantification can be largely divided into two categories: transcript-based approach and ‘union exon’-based approach.
 
It was found that the gene expression levels are significantly underestimated by ‘union exon’-based approach, and the average of RPKM from ‘union exons’-based method is less than 50% of the mean expression obtained from transcript-based approach.
 
== FPKM (Trapnell et al. 2010) ==
 
* Fragment per Kilobase of exon per Million of Mapped fragments (Cufflinks).
* FPKM is very similar to RPKM. RPKM was made for single-end RNA-seq, where every read corresponded to a single fragment that was sequenced. FPKM was made for paired-end RNA-seq. With paired-end RNA-seq, two reads can correspond to a single fragment, or, if one read in the pair did not map, one read can correspond to a single fragment. The only difference between RPKM and FPKM is that FPKM takes into account that two reads can map to one fragment (and so it doesn’t count this fragment twice).
* [https://support.bioconductor.org/p/9154302/ Differential expression analysis with only FPKM matrix available from total newbie in R]
 
== Gene length ==
<pre>
library(AnnotationHub)
library(airway)
library(SummarizedExperiment)
 
# Load the airway dataset
data("airway")
counts <- assay(airway)
counts <- as.matrix(counts)  # Ensure it's a matrix
 
# TPM Calculation Function
compute_tpm <- function(counts, lengths) {
  length_scaled <- counts / lengths
  scaling_factors <- colSums(length_scaled)
  tpm <- t(t(length_scaled) / scaling_factors) * 1e6
  return(tpm)
}
 
BiocManager::install("biomaRt")  # If not installed yet
library(biomaRt)
# Connect to Ensembl BioMart for human
mart <- useMart("ENSEMBL_MART_ENSEMBL", dataset = "hsapiens_gene_ensembl")
# Fetch gene lengths for human genes
gene_lengths <- getBM(
  attributes = c("ensembl_gene_id", "gene_biotype", "transcript_length"),  # Attribute options
  mart = mart
)
 
# Make sure to use ENSEMBL IDs (Ensembl Gene IDs) from the airway data
head(gene_lengths)
  ensembl_gene_id  gene_biotype transcript_length
1 ENSG00000210049        Mt_tRNA                71
2 ENSG00000211459        Mt_rRNA              954
3 ENSG00000210077        Mt_tRNA                69
 
library(TxDb.Hsapiens.UCSC.hg38.knownGene)
# Extract the transcripts
txdb <- TxDb.Hsapiens.UCSC.hg38.knownGene
genes <- genes(txdb)
length(genes)
# [1] 30969
names(genes)[1:5]
# [1] "1"        "10"        "100"      "1000"      "100008586"
 
# Calculate lengths (this uses the exons of the genes)
gene_lengths <- width(reduce(genes))
gene_lengths <- as.numeric(gene_lengths)
length(gene_lengths)
# [1] 26269
gene_lengths[1:3]
# [1] 2541 1556 6167
</pre>
 
== [http://www.rna-seqblog.com/rpkm-fpkm-and-tpm-clearly-explained/ RPKM, FPKM, TPM and DESeq] ==
* RPKM can be calculated using the '''edgeR''' package if we have the raw count data (e.g. Rsubread::'''featureCount'''()). [http://combine-australia.github.io/RNAseq-R/07-rnaseq-day2.html Rsubread is the only R package that can run in R].
* The youtube video is on [https://www.youtube.com/watch?t=119&v=TTUrtCY2k-w here]. TPM 比 RPKM/FPKM 好因為 total reads in each experiments are the same.
* [https://reneshbedre.github.io/blog/expression_units.html Relationship (formula) between RPKM and TPM]
* [https://arxiv.org/pdf/1804.06050.pdf#page=5 Differences]
** The main difference between RPKM and FPKM is that the former is a unit based on single-end reads, while the latter is based on paired-end reads and counts the two reads from the same RNA fragment as one instead of two.
** The difference between RPKM/FPKM and TPM is that the former calculates sample-scaling factors before dividing read counts by gene lengths, while the latter divides read counts by gene lengths first and calculates samples calling factors based on the length-normalized read counts.
** If researchers would like to interpret gene expression levels as the proportions of RNA molecules from different genes in a sample,
* [https://zhuanlan.zhihu.com/p/55988984 为什么说FPKM和RPKM都错了?]
* [http://diytranscriptomics.com/Reading/files/wagnerTPM.pdf Measurement of mRNA abundance using RNA-seq data: RPKM measure is inconsistent among samples] (TPM method) by Wagner 2012.
* Between samples normalization.
** [https://groups.google.com/forum/#!topic/sailfish-users/jBf9SGiH1AM How to Normalize Salmon TPM output?]
** [https://www.biostars.org/p/287296/ How do I normalize for my RNA-seq data across different samples in different conditions]. Using DESeq2 ([https://genomebiology.biomedcentral.com/track/pdf/10.1186/s13059-014-0550-8 paper], [https://www.rdocumentation.org/packages/DESeq2/versions/1.12.3/topics/estimateSizeFactors estimateSizeFactors()]). [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3218662/pdf/gb-2010-11-10-r106.pdf DESeq] paper by Anders 2010 where the NB model and size factor was first used.
: <syntaxhighlight lang='rsplus'>
> set.seed(1)
> dds <- makeExampleDESeqDataSet(m=4)
> head(counts(dds))
      sample1 sample2 sample3 sample4
gene1      14      1      1      4
gene2      5      17      13      14
gene3      0      12      8      6
gene4    152      62    149    110
gene5      23      36      33      94
gene6      0      1      1      4
> dds <- estimateSizeFactors(dds)
> sizeFactors(dds)
sample1  sample2  sample3  sample4
1.068930 1.014687 1.010392 1.033559
> head(counts(dds))
      sample1 sample2 sample3 sample4
gene1      14      1      1      4
gene2      5      17      13      14
gene3      0      12      8      6
gene4    152      62    149    110
gene5      23      36      33      94
gene6      0      1      1      4
> head(counts(dds, normalized=TRUE))
        sample1    sample2    sample3    sample4
gene1  13.097206  0.9855256  0.9897147  3.870122
gene2  4.677574 16.7539354  12.8662916  13.545427
gene3  0.000000 11.8263073  7.9177179  5.805183
gene4 142.198237 61.1025878 147.4674957 106.428358
gene5  21.516838 35.4789219  32.6605863  90.947869
gene6  0.000000  0.9855256  0.9897147  3.870122
 
# normalized counts is calculated as the following
R> head(scale(counts(dds, normalized=F), F, sizeFactors(dds)))
        sample1    sample2    sample3    sample4
gene1  13.097206  0.9855256  0.9897147  3.870122
gene2  4.677574 16.7539354  12.8662916  13.545427
gene3  0.000000 11.8263073  7.9177179  5.805183
gene4 142.198237 61.1025878 147.4674957 106.428358
gene5  21.516838 35.4789219  32.6605863  90.947869
gene6  0.000000  0.9855256  0.9897147  3.870122
 
# The situation of DESeqDataSet object created using 'tximport()' is different. See the next item.
</syntaxhighlight>
* [https://www.rdocumentation.org/packages/DESeq2/versions/1.12.3/topics/estimateSizeFactors ?estimateSizeFactors()]. If tximport is used, the information in <nowiki>assays(dds)[["avgTxLength"]] </nowiki> is automatically used to create appropriate normalization factors. In this case, sizeFactors(dds) will return NULL. See also [[R#Debug_an_S4_function|Debug an S4 function]] for the source code.
* TPM (generated by [https://deweylab.github.io/RSEM/ RSEM] or [https://combine-lab.github.io/salmon/ Salmon] or [https://pachterlab.github.io/kallisto/starting Kallisto]) has been suggested as a better unit than RPKM/FPKM. But it cannot be used to do comparison between samples.
** [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3163565/ RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome] Li 2011, 8k citations from google scholar.
** RPKM or TPM only corrects for library size, but not composition. [https://support.bioconductor.org/p/9159683/ Size factor normalized counts for between sample comparisons]
** [http://www.arrayserver.com/wiki/index.php?title=TPM_and_FPKM TPM and FPKM] from array suite wiki
** [https://haroldpimentel.wordpress.com/2014/05/08/what-the-fpkm-a-review-rna-seq-expression-units/ What the FPKM? A review of RNA-Seq expression units]. R code for computing effective counts, TPM, and FPKM.
** [https://haroldpimentel.wordpress.com/2014/12/08/in-rna-seq-2-2-between-sample-normalization/ In RNA-Seq, 2 != 2: Between-sample normalization]. Among the most popular and well-accepted BSN (between-sample normalization) methods are TMM and DESeq normalization.
: <syntaxhighlight lang='bash'>
P -- per
K -- kilobase (related to gene length)
M -- million (related to sequencing depth)
</syntaxhighlight>
* [https://www.biostars.org/p/329625/ How to convert transcript level TPM to gene level TPM ?]
* [https://github.com/crazyhottommy/RNA-seq-analysis/blob/master/salmon_kalliso_STAR_compare.md R scripts to convert HTseq counts to TPM]
* [https://www.biostars.org/p/171766/ Calculating TPM from featureCounts output], [https://gist.github.com/slowkow/c6ab0348747f86e2748b A simpler version]. It seems CPM and TPM 差別再 TPM 考慮gene length.
* [https://hbctraining.github.io/DGE_workshop_salmon/lessons/02_DGE_count_normalization.html Comparison of common normalization methods] from a workshop from Harvard Chan Bioinformatics Core.
* [https://rnajournal.cshlp.org/content/early/2020/04/13/rna.074922.120 Misuse of RPKM or TPM normalization when comparing across samples and sequencing protocols] Zhao 2020
** It can be reasonable to assume that the partitioning of total RNA among the different compartments ('''ribosomal RNA, pre-mRNA, mitochondrial RNA, genomic pre-mRNA and poly(A)+ RNA''') of the transcriptome is '''comparable''' across samples in a given RNA-seq project.
* [https://reneshbedre.github.io/blog/expression_units.html#tmm-trimmed-mean-of-m-values Gene expression units explained: RPM, RPKM, FPKM, TPM, DESeq, TMM, SCnorm, GeTMM, and ComBat-Seq]
* [https://pubmed.ncbi.nlm.nih.gov/34158060/ TPM, FPKM, or Normalized Counts? A Comparative Study of Quantification Measures for the Analysis of RNA-seq Data from the NCI Patient-Derived Models Repository] Zhao 2021
 
== Sample size ==
[[Power#RNA-seq|Power-> RNA-seq]]
 
== Coverage ==
* [https://genohub.com/recommended-sequencing-coverage-by-application/ Recommended Coverage and Read Depth for NGS Applications] from @Genohub.
* [http://bedtools.readthedocs.org/en/latest/content/tools/coverage.html bedtools]. The bedtools is now hosted on [https://github.com/arq5x/bedtools2 github]
* https://github.com/alyssafrazee/polyester
<pre>
~20x coverage ----> reads per transcript = transcriptlength/readlength * 20
</pre>
* Page 18 of this [http://www.chem.agilent.com/Library/eseminars/Public/RNA%20Sequencing%20101.pdf RNA-Seq 101] from Agilent or [http://res.illumina.com/documents/products/technotes/technote_coverage_calculation.pdf Estimating Sequencing Coverage] from Illumina.
<pre>
C = L N / G
</pre>
where L=read length, N =number of reads and G=haploid genome length. So, if we take one lane of single read human sequence with v3 chemistry, we get C = (100 bp)*(189×10^6)/(3×10^9 bp) = 6.3. This tells us that each base in the genome will be sequenced between six and seven times on average.
* coverage() function in IRanges package.
* [https://github.com/fbreitwieser/bamcov bamcov] - Quickly calculate and visualize sequence coverage in alignment files
* [https://www.biostars.org/p/6571/ Coverage and read depth]
* [https://www.biostars.org/p/638/ What Is The Sequencing 'Depth' ?] Coverage = (total number of bases generated) / (size of genome sequenced). So a 30x coverage means, on an average each base has been read by 30 sequences.
* [http://www.nature.com/nrg/journal/v15/n2/full/nrg3642.html Sequencing depth and coverage: key considerations in genomic analyses]
* [http://qualimap.bioinfo.cipf.es/doc_html/index.html Qualimap]
* https://www.biostars.org/p/5165/
<syntaxhighlight lang='bash'>
# Assume the bam file is sorted by chromosome location
# took 40 min on 5.8G bam file. samtools depth has no threads option:(
# it is not right since it only account for regions that were covered with reads
samtools depth  *bamfile*  |  awk '{sum+=$3} END { print "Average = ",sum/NR}'    # maybe 42
 
# The following is the right way! The result matches with Qualimap program.
samtools depth -a *bamfile*  |  awk '{sum+=$3} END { print "Average = ",sum/NR}'  # maybe 8
# OR
LEN=`samtools view -H bamfile | grep -P '^@SQ' | cut -f 3 -d ':' | awk '{sum+=$1} END {print sum}'`  # 3095693981
SUM=`samtools depth bamfile | awk '{sum+=$3} END { print "Sum = ", sum}'`  # 24473867730
echo $(( $LEN/$SUM ))
</syntaxhighlight>
 
== 5 common genomics file formats ==
[https://youtu.be/MrVpn0vpIYU 5 genomics file formats you must know] (video)
* fastq,
* fastq,
* bam,
* vcf,
* [https://m.ensembl.org/info/website/upload/bed.html bed] (genomic intervals regions)
 
== SAM/Sequence Alignment Format and BAM format specification ==
* https://samtools.github.io/hts-specs/SAMv1.pdf and [http://samtools.sourceforge.net/ samtools] webpage.
* http://genome.sph.umich.edu/wiki/SAM
 
== Single-end, pair-end, fragment, insert size ==
* [http://thegenomefactory.blogspot.com/2013/08/paired-end-read-confusion-library.html Paired-end read confusion - library, fragment or insert size?]
* https://www.biostars.org/p/95803/
 
== Germline vs Somatic mutation ==
* Germline: inherit from parents. See the [https://en.wikipedia.org/wiki/Germline Wikipedia] page.
* Somatic SNVs are mutations that occur in the cells of a tumor. These mutations can be found in '''multiple copies of the same gene''', while germline SNVs are mutations that are found in '''a single copy of the gene''', usually the original copy.
* [https://my.clevelandclinic.org/health/body/23067-somatic--germline-mutations Somatic & Germline Mutations]
 
== Pathogenic mutation ==
* A [https://www.thinkgenetic.com/reference/genetic-testing/genetic-testing/358 pathogenic mutation] is a change in the genetic sequence that causes a specific genetic disease. To determine if a change found in the gene is something that causes disease, a laboratory looks at many different factors. For example, they look at the type of change found. Some changes, like nonsense mutations or frameshift mutations, almost always result in a major problem with the protein produced, so they are often labeled as pathogenic mutations. Laboratories will also check the scientific literature and databases to see if the particular change has been reported in other individuals with the genetic disease. Lastly, they look to see if the change is in an area of the gene that is conserved across species, meaning that the area where the change is located is the same in lots of animals, thus may be an important area for the function of the protein.
* pathogenic variant. See [https://my.clevelandclinic.org/health/diseases/21751-genetic-disorders Genetic Disorders]
* [https://www.collinsdictionary.com/dictionary/english/pathogenic-mutations Pathogenic] means ''able to cause or produce disease''.
* What are some examples of genetic diseases caused by pathogenic mutations? Cystic fibrosis, Duchenne muscular dystrophy, Familial hypercholesterolemia, Hemochromatosis, Sickle cell disease, Tay-Sachs disease ...
 
== Driver vs passenger mutation ==
https://en.wikipedia.org/wiki/Somatic_evolution_in_cancer
 
== Nonsynonymous mutation ==
It is related to the [http://www.chemguide.co.uk/organicprops/aminoacids/dna4.html genetic code], [https://en.wikipedia.org/wiki/Genetic_code Wikipedia]. There are 20 amino acids though there are 64 codes.
 
See
* http://evolution.about.com/od/Overview/a/Synonymous-Vs-Nonsynonymous-Mutations.htm
* https://en.wikipedia.org/wiki/Nonsynonymous_substitution
* [http://thegenomefactory.blogspot.com/2013/10/understanding-snps-and-indels-in.html Understanding SNPs and INDELs in microbial genomes]
* An example from https://en.wikipedia.org/wiki/Silent_mutation
** nonsynonymous: ATG to GTG mutation (AUG = Met, GUG = Val)
** synonymous: CAT to CAC mutation (CAU = His, CAC = His)
 
== isma: analysis of mutations detected by multiple pipelines ==
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2701-0 isma]: an R package for the integrative analysis of mutations detected by multiple pipelines
 
== mutSignatures: analysis of cancer mutational signatures ==
* [https://www.nature.com/articles/s41598-020-75062-0#data-availability MutSignatures]: an R package for extraction and analysis of cancer mutational signatures
* https://github.com/dami82/mutSignatures
 
== Rediscover: identify mutually exclusive mutations ==
[https://academic.oup.com/bioinformatics/article-abstract/38/3/844/6401995 Rediscover: an R package to identify mutually exclusive mutations]
 
== Tumor mutational burden ==
* https://en.wikipedia.org/wiki/Tumor_mutational_burden
** '''Treatment Response''': An analysis of a large cohort of patients receiving ''ICI (immune checkpoint inhibitors)'' therapy revealed that higher TMB levels (≥ 20 mutations/Mb) corresponded to a 58% response rate to ICIs while lower TMB levels (<20 mutations/Mb) reduced response to 20%.
** '''Cut-offs (High and low TMB status)''': Different studies have assigned different cut-offs to delineate between high and low TMB status.
* Tumor Mutation Burden (TMB) is typically calculated '''per sample''', not per gene. It is defined as the number of non-synonymous somatic mutations (single nucleotide variants and small insertions/deletions) per megabase in coding regions.
** The data range of TMB can vary widely depending on the '''type of cancer''' and the individual patient’s tumor. For example, one study showed that TMB can range from 0.03 to 14.13 mutations per megabase in a prostate cancer cohort, while this range is from 0.04-99.68 mutations per megabase in a bladder cancer cohort.
** '''Different sources''' may categorize TMB levels differently. For instance, one source suggests that a TMB score lower than 10 is considered low, between 10 and 15 is intermediate, and larger than 15 is high. Another source suggests that low TMB is less than or equal to 5 mutations/Mb, intermediate TMB is greater than 5 and less than 20, high TMB is greater than or equal to 20 and less than 50, and very high TMB is greater than or equal to 50.
* [https://bmcimmunol.biomedcentral.com/articles/10.1186/s12865-018-0285-5 Correlate tumor mutation burden with immune signatures in human cancers] Wang 2019
** Definition of cutoff: higher-TMB samples (the samples with TMB scores of ''upper quartile'') and lower-TMB samples (the samples with TMB scores of ''lower quartile'')
** '''Higher TMB was associated with better survival prognosis''' in numerous cancer types while was associated with worse prognosis in a few cancer types.
** Our data implicate that '''higher-TMB patients could gain a more favorable prognosis in diverse cancer types if treated with immunotherapy''', otherwise would have a poorer prognosis compared to lower-TMB patients.
** '''Higher nonsynonymous mutation burden in tumors''' is inclined to form more neoantigens that make tumors to have higher immunogenicity, and thus result to improved clinical response to '''immunotherapy'''.
** Address several questions:
*** Is the '''immune activity''' (expression levels of immune-related genes) of the higher-TMB subtype different from that of the lower-TMB subtype of cancers?  Wilcoxon rank-sum test. Fisher’s exact test & OR.
*** Are there any immune-related genes or gene-sets which are differentially expressed between the lower-TMB subtype and the higher-TMB subtype of cancers and whose expression is associated with clinical outcomes in cancer? Wilcoxon rank-sum test. Fisher’s exact test & OR.
*** Is the TMB itself associated with clinical outcomes in cancer? Log-rank tests.
* [https://cancerci.biomedcentral.com/articles/10.1186/s12935-020-01472-9 Significance of tumor mutation burden combined with immune infiltrates in the progression and prognosis of ovarian cancer] Bi 2020
* [https://pubmed.ncbi.nlm.nih.gov/33125859/ The Challenges of Tumor Mutational Burden as an Immunotherapy Biomarker] 2020
* [https://aacrjournals.org/cancerdiscovery/article/10/12/1808/2595/Tumor-Mutational-Burden-as-a-Predictive-Biomarker Tumor Mutational Burden as a Predictive Biomarker in Solid Tumors] 2020
* [https://bioconductor.org/packages/release/bioc/vignettes/maftools/inst/doc/maftools.html maftools] Summarize, Analyze and Visualize MAF Files
* [https://www.biomedcentral.com/search?query=TMB&searchType=publisherSearch 2449 result(s) for 'TMB'] from BMC
* [https://www.biostars.org/p/431067/ How to calculate TMB for somatic data TCGA]
* [https://www.biostars.org/p/299549/ Question: TMB Tumor Mutation Burden]
* [https://pubmed.ncbi.nlm.nih.gov/32239176/ Mining TCGA database for tumor mutation burden and their clinical significance in bladder cancer]
* [https://jitc.bmj.com/content/8/1/e000147.long Establishing guidelines to harmonize tumor mutational burden (TMB): in silico assessment of variation in TMB quantification across diagnostic platforms] 2020
* [https://github.com/bioinfo-pf-curie/TMB TMB (python] - This tool was designed to calculate a Tumor Mutational Burden (TMB) score from a VCF file.
* [https://acc-bioinfo.github.io/TMBleR/index.html TMBleR] R package, docker, shiny.
* [https://github.com/jasonwong-lab/TMB TMB prediction App] R, shiny
* [https://www.r-bloggers.com/2023/01/an-r-function-to-compute-tumor-mutational-burden-tmb/ An R function to compute Tumor Mutational Burden (TMB)]
* [https://www.sciencedirect.com/science/article/pii/S0923753421044951 Aligning tumor mutational burden (TMB) quantification across diagnostic platforms: phase II of the Friends of Cancer Research TMB Harmonization Project] 2021.
** TMB can be determined by '''selected targeted panels''' in most cases, and '''whole-exome sequencing (WES)''' is the gold standard for quantifying TMB. TMB derived from panels was consistently and significantly lower than that derived from a whole exome. See this paper [https://jitc.bmj.com/content/8/1/e000613 Comparison of commonly used solid tumor targeted gene sequencing panels for estimating tumor mutation burden shows analytical and prognostic concordance within the cancer genome atlas cohort] 2020.
 
== Types of mutations ==
* [https://www.technologynetworks.com/genomics/articles/missense-nonsense-and-frameshift-mutations-a-genetic-guide-329274 Missense, Nonsense and Frameshift Mutations: A Genetic Guide]
* [https://bio.libretexts.org/Bookshelves/Introductory_and_General_Biology/Principles_of_Biology/02%3A_Chapter_2/14%3A_Mutations/14.05%3A_Types_of_Mutations 4.5: Types of Mutations] by LibreTexts biology.
** While these mutation types are distinct, they can overlap in the sense that a single event (like an insertion or deletion) can result in a frameshift mutation.
 
== Cytogenetic alternations ==
* [https://pubmed.ncbi.nlm.nih.gov/25574665/ Combining gene mutation with gene expression data improves outcome prediction in myelodysplastic syndromes] Gerstung 2015
* [https://academic.oup.com/bioinformatics/article/37/23/4589/6380545 RCytoGPS: an R package for reading and visualizing cytogenetics data]
 
== Alternative and differential splicing ==
* [http://www.rna-seqblog.com/best-practices-and-appropriate-workflows-to-analyse-alternative-and-differential-splicing/ Best practices and appropriate workflows to analyse alternative and differential splicing]
* [https://www.rna-seqblog.com/as-cmc-a-pan-cancer-database-of-alternative-splicing-for-molecular-classification-of-cancer/ AS-CMC – a pan-cancer database of alternative splicing for molecular classification of cancer]
 
== Allele vs Gene ==
http://www.diffen.com/difference/Allele_vs_Gene
 
* A gene is a stretch of DNA or RNA that determines a certain trait.
* Genes mutate and can take two or more alternative forms; an '''allele''' is one of these forms of a gene. For example, the gene for eye color has several variations (alleles) such as an allele for blue eye color or an allele for brown eyes.
* An allele is found at a fixed spot on a chromosome?
* Chromosomes occur in pairs so organisms have two alleles for each gene — one allele in each chromosome in the pair. Since each chromosome in the pair comes from a different parent, organisms inherit one allele from each parent for each gene. The two alleles inherited from parents may be same (homozygous) or different (heterozygotes).
 
== Locus ==
https://en.wikipedia.org/wiki/Locus_(genetics)
 
== [https://en.wikipedia.org/wiki/Haplotype Haplotypes] ==
* http://www.brown.edu/Research/Istrail_Lab/proj_cmsh.php
* http://www.nature.com/nri/journal/v5/n1/fig_tab/nri1532_F2.html
* https://www.sciencenews.org/article/seeking-genetic-fate
* http://www.medscape.com/viewarticle/553400_3
 
== Base quality, Mapping quality, Variant quality ==
* Fastq base quality: https://en.wikipedia.org/wiki/FASTQ_format
* Mapping quality: http://genome.cshlp.org/content/18/11/1851.long
* Variant quality: http://www.ncbi.nlm.nih.gov/pubmed/21903627
 
== VarSAP ==
[https://bioinformatics.georgetown.edu/internships/enrichment-of-variant-information-for-the-variant-standardization-and-annotation-pipeline/ Enrichment of Variant Information for the Variant Standardization and Annotation Pipeline]
 
== The Clinical Knowledgebase (CKB) ==
https://ckb.jax.org/gene/show?geneId=7157  (TP53)
 
== Mapping quality (MAPQ) vs Alignment score (AS) ==
http://seqanswers.com/forums/showthread.php?t=66634 & [https://samtools.github.io/hts-specs/SAMv1.pdf SAM format specification]
 
* MAPQ (5th column): MAPping Quality. It equals '''−10 log10 Pr{mapping position is wrong}''' (defined by SAM documentation), rounded to the nearest integer. A value 255 indicates that the mapping quality is not available. MAPQ is a metric that tells you how confident you can be that the read comes from the reported position. So given 1000 reads, for example, read alignments with mapping quality being 30, one of them will be wrong in average (10^(30/-10)=.001). Another example, if MAPQ=70, then the probability mapping position is wrong is 10^(70/-10)=1e-7. We can use 'samtools view -q 30 input.bam' to keep reads with MAPQ at least 30. Users should refer to the alignment program for the 'MAPQ' value it uses.
* AS (optional, 14th column in my case): Alignment score is a metric that tells you how similar the read is to the reference. AS increases with the number of matches and decreases with the number of mismatches and gaps (rewards and penalties for matches and mismatches depend on the scoring matrix you use)
 
Note:
# '''MAPQ scores produced by the aligners typically involves the alignment score and other information.'''
# You can have high AS and low MAPQ if the read aligns perfectly at multiple positions, and you can have low AS and high MAPQ if the read aligns with mismatches but still the reported position is still much more probable than any other.
# You probably want to filter for MAPQ, but "good" alignment may refer to AS if what you care is similarity between read and reference.
# [https://sequencing.qcfail.com/articles/mapq-values-are-really-useful-but-their-implementation-is-a-mess/ MAPQ values are really useful but their implementation is a mess] by Simon Andrews
 
== gene's isoform ==
* https://en.wikipedia.org/wiki/RNA-Seq#Alternative_splicing
* [https://www.longdom.org/open-access/bioinformatics-tools-for-rnaseq-gene-and-isoform-quantification-2469-9853-1000140.pdf Bioinformatics Tools for RNA-seq Gene and Isoform Quantification] 2016. Figure 1 gives an illustration how isoform can affect the computation of RPKM.
* [https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-017-4002-1 Evaluation and comparison of computational tools for RNA-seq isoform quantification] BMC Genomics 2017.
* [https://www.gettinggeneticsdone.com/2012/12/differential-isoform-expression-cuffdiff2.html Differential Isoform Expression With RNA-Seq: Are We Really There Yet?]
* An example of unidentified transcript-level estimates while gene-level estimation is still possible. Figure 1C in [https://f1000research.com/articles/4-1521/v2 Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences]
* [https://academic.oup.com/bioinformatics/article/38/15/3844/6617821?login=false ggtranscript: an R package for the visualization and interpretation of transcript isoforms using ggplot2] 2022
 
== FFPE Tissue vs Frozen Tissue ==
* [https://www.biochain.com/general/what-is-ffpe-tissue/ What Is FFPE Tissue And What Are Its Uses]
* [https://rna-seqblog.com/a-new-model-to-predict-survival-in-colorectal-cancer-from-rna-seq-data/ A new model to predict survival in colorectal cancer from DNA / RNA-Seq data]
 
== Wild type vs mutant ==
* [https://pediaa.com/difference-between-wild-type-and-mutant/ Difference Between Wild Type and Mutant]
* https://en.wikipedia.org/wiki/Wild_type
 
== ns ==
Not significant
 
== PARP inhibitor ==
* [https://youtu.be/vwZ07CX7ZKU?t=70 What is a PARP Inhibitor?] Dana-Farber Cancer Institute
* '''PARP''' is an '''enzyme'''/a family of '''proteins''' that help '''repair damaged DNA''' in cells. When DNA is damaged, PARP detects the damage and signals other '''enzymes''' to come and fix it. This helps maintain the stability of the cell’s genetic material and prevent cell death.
* Is PARP good or bad? PARP is neither inherently good nor bad. It is a protein that plays an important role in maintaining the stability of the cell’s genetic material by helping to repair damaged DNA.
** In normal cells, PARP helps prevent cell death and maintain genomic stability.
** In cancer cells, PARP can help the cancer cells survive and continue to grow by repairing their DNA. This is why PARP inhibitors (PARPi) are used in cancer treatment to block the function of PARP and prevent cancer cells from repairing their DNA.
 
* PARP inhibitors are a type of '''targeted cancer therapy''', '''not a traditional chemotherapy'''.
 
* '''PARPi''' therapy is a cancer treatment that blocks the PARP enzyme, which helps repair DNA damage in cancer cells
** [https://pubmed.ncbi.nlm.nih.gov/33015058/ PARP Inhibitors: Clinical Relevance, Mechanisms of Action and Tumor Resistance]
** [https://www.drugs.com/drug-class/parp-inhibitors.html List of PARP inhibitors]: olaparib, niraparib, rucaparib, and talazoparib.
** [https://en.wikipedia.org/wiki/Olaparib Olaparib] is a medication for the maintenance treatment of BRCA-mutated advanced ovarian cancer in adults. It is a PARP inhibitor, inhibiting poly ADP ribose polymerase (PARP), an enzyme involved in DNA repair. Others include Letrozole, Avastin.
** '''[https://www.cancer.net/navigating-cancer-care/how-cancer-treated/what-maintenance-therapy Maintenance therapy]''' is called so because it is the ongoing treatment of cancer with medication after the cancer has responded to the first recommended treatment. The main goals of maintenance therapy are
*** To prevent the cancer’s return
*** To delay the growth of advanced cancer after the initial treatment
* '''PARP inhibitors''' are a class of '''drugs''' that inhibit the activity of PARP enzymes. By blocking PARP’s ability to help repair DNA damage, these drugs can make it more difficult for cancer cells to survive DNA damage caused by other treatments, such as chemotherapy or radiation therapy. This can make these treatments more effective against certain types of cancer.
* PARP inhibitors are drugs that block the action of the PARP enzymes, which are involved in DNA repair. There are several PARP inhibitors available, including olaparib (Lynparza), niraparib (Zejula), rucaparib (Rubraca), and talazoparib (Talzenna). These drugs are approved for some types of cancer, such as ovarian and prostate cancer, depending on the presence of certain genetic mutations.
** [https://www.medicalnewstoday.com/articles/parp-inhibitor What is a PARP inhibitor? Uses, how they work, and options].
** PARP inhibitors - [https://www.drugs.com/drug-class/parp-inhibitors.html Drugs.com].
 
== Inhibitor genes and activator genes/enhancer genes ==
* Inhibitor genes: Inhibitor genes are genes that code for proteins that can regulate or inhibit the activity of other genes or proteins in a cell. These inhibitor proteins can interact with other proteins to prevent them from functioning or alter their activity.
** '''TP53''' gene, which codes for the p53 protein, a tumor suppressor protein that plays a critical role in regulating cell division and preventing the formation of cancerous tumors. Mutations in the '''TP53''' gene can result in loss of p53 function and an increased risk of cancer.
 
* Activator genes: Activator genes play crucial roles in a variety of biological processes, including embryonic development, immune system responses, and the regulation of gene expression. For example, the NF-kB gene codes for a transcription factor that activates genes involved in immune system responses.
** The '''MYC''' gene is an oncogene that codes for a transcription factor that promotes cell growth and proliferation. Dysregulation or overexpression of MYC can contribute to the development of many types of cancer.
** Overexpression of the '''HER2''' (human epidermal growth factor receptor 2) gene is commonly observed in certain types of cancer, particularly breast cancer. Approximately 20-25% of breast cancer cases overexpress HER2, which is associated with a more aggressive form of the disease.
** Overexpression of the epidermal growth factor receptor ('''EGFR''') gene is a common genetic alteration observed in glioblastoma multiforme (GBM) patients.
 
* It's important to note that the distinction between inhibitor and activator genes is not always clear-cut, as many genes can have both inhibitory and activating effects depending on the context and the specific proteins they interact with.
 
* '''Normal/cancer cells and PARP Inhibition''':
** '''Normal cells''' can tolerate DNA damage caused by PARP inhibition due to their efficient '''homologous recombination (HR) mechanism'''.
** In contrast, '''cancer cells''' with a '''deficient HR''' struggle to manage the DNA double-strand breaks (DSBs) and are '''especially sensitive''' to the effects of PARP inhibitors (PARPi)
** '''PARP''' has been found to be '''overexpressed''' in various types of cancers, including breast, ovarian, and oral cancers, compared to their corresponding normal healthy tissues.
** This overexpression makes '''inhibition of PARP activity''' an attractive strategy for cancer therapeutics. By disrupting PARP functions, it impairs DNA damage repair (DDR) pathways in cancer cells.
** After cancer patients receive PARP inhibitor '''(PARPi) drugs''', the expression of PARP genes in cancer patients tends to be '''lower''' compared to normal patients.
 
== Undifferentiated cancer ==
* [https://www.medicinenet.com/undifferentiated_cancer/definition.htm Medical Definition of Undifferentiated cancer] (不好的 tumor)
* What are undifferentiated cells
** Undifferentiated cells are cells that have not yet developed into a specific type of cell and do not possess the characteristics of a fully differentiated cell. They are also known as '''stem cells''' or '''progenitor cells'''.
** In developmental biology, undifferentiated cells are the cells that have not yet undergone differentiation, the process by which a less specialized cell becomes a more specialized cell, with a specific function and characteristics. These cells have the potential to divide and differentiate into multiple cell types, either through normal development or in response to injury or disease.
** In the context of cancer, '''undifferentiated''' cells refer to cells that have not yet developed into a specific type of cancer cell. These cells are sometimes called '''cancer stem cells''', and they are thought to be the cells that give rise to the various types of cells within a tumor. '''They are believed to be responsible for the maintenance and growth of the tumor''', and for its ability to spread to other parts of the body. They can be found within many types of cancer, and are considered to be an important target for cancer therapy, as ''they are thought to be more resistant to traditional treatments such as chemotherapy and radiation''.
* '''Differentiation''' refers to the process by which cells develop and mature to perform specific functions. Normal cells are considered highly differentiated because they have specialized structures and functions. When cancer cells are described as '''well-differentiated,''' it means that these cells have retained many of the characteristics and functions of normal cells. In contrast:
** '''Moderately differentiated''' cancer cells have lost some of these normal characteristics and appear more abnormal.
** '''Poorly differentiated''' cancer cells look very different from normal cells and lack the specialized functions of healthy tissue. They tend to grow and spread more aggressively because they are less "mature" in their development.
 
* '''Undifferentiated cancers generally have a worse prognosis compared to well-differentiated tumors for several reasons''':
** Aggressive behavior: Undifferentiated cancer cells tend to grow and spread more quickly than well-differentiated cells.
** Lack of normal cell functions: These cancer cells have lost many of the characteristics and functions of normal cells, making them more difficult for the body to control or recognize.
** Resistance to treatment: Undifferentiated cancers often respond poorly to conventional treatments like chemotherapy.
** Advanced stage at diagnosis: These cancers are frequently diagnosed at later stages due to their rapid progression and difficulty in detection.
** Cellular disorganization: The lack of cellular organization makes these tumors more invasive and harder to treat surgically.
** Difficulty in targeting: The absence of specific cellular markers makes it challenging to develop targeted therapies.
** Rapid metastasis: Undifferentiated cancers have a higher tendency to spread to other parts of the body quickly
 
* [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE164174 GSE164174]
 
== NCI Information Technology for Cancer Research program /ITCR ==
https://itcr.cancer.gov/. [https://itcr.cancer.gov/videos Videos]. It sponsors several programs like Bioconductor, GenePattern, UCSC Xena, IGV, PDX Finder, WebMeV, et al.
 
= Other software =
== Partek ==
* [https://www.partek.com/application-page/single-cell-gene-expression/ Single Cell RNA-Seq]
* Partek Flow Software http://youtu.be/-6aeQPOYuHY
* [https://youtu.be/tZ4BhhVCJfU?t=893 RNA Seq Analysis with Partek Flow]
* [https://www.youtube.com/watch?v=cj9M--9zzgI&list=PLLFT1pfBxZZj8xOCjZTFjt3EX7jqvUgDm A playlist of Single Cell Analysis with Partek Flow Bioinformatics Software] (WTH the videos are 720p only)
* [https://youtu.be/iT63UZGXzu0 Understanding RNA-Seq Data Analysis: A Back-to-basics Overview]
* https://partekflow.cit.nih.gov/
 
== [http://www.hsph.harvard.edu/cli/complab/dchip/ dCHIP] ==
 
== [http://www.tm4.org/mev/ MeV] ==
 
MeV v4.8 (11/18/2011) allows annotation from Bioconductor
 
== IPA from Ingenuity ==
Login:
There are web started version https://analysis.ingenuity.com/pa and Java applet version https://analysis.ingenuity.com/pa/login/choice.jsp. We can double click the file <IpaApplication.jnlp> in my machine's download folder.
 
Features:
* easily search the scientific literature/integrate diverse biological information.
* build dynamic pathway models
* quickly analyze experimental data/Functional discovery: assign function to genes
* share research and collaborate. On the other hand, IPA is web based, so it takes time for running analyses. Once submitted analyses are done, an email will be sent to the user.
 
Start Here
<pre>
Expression data -> New core analysis -> Functions/Diseases -> Network analysis
                                        Canonical pathways        |
                                              |                  |
Simple or advanced search --------------------+                  |
                                              |                  |
                                              v                  |
                                        My pathways, Lists <------+
                                              ^
                                              |
Creating a custom pathway --------------------+
</pre>
 
Resource:
* http://bioinformatics.mdanderson.org/MicroarrayCourse/Lectures09/Pathway%20Analysis.pdf
* http://libguides.mit.edu/content.php?pid=14149&sid=843471
* http://people.mbi.ohio-state.edu/baguda/PathwayAnalysis/
* IPA 5.5 manual http://people.mbi.ohio-state.edu/baguda/PathwayAnalysis/ipa_help_manual_5.5_v1.pdf
* [http://ingenuity.force.com/ipa Help and supports]
* [http://ingenuity.force.com/ipa/articles/Tutorial/Tutorials Tutorials] which includes
* [http://ingenuity.force.com/ipa/articles/Tutorial/Tutorials Tutorials] which includes
** Search for genes
** Search for genes
** Analysis results
** Analysis results
** Upload and analyze example data
** Upload and analyze example data
** Upload and analyze your own expression data
** Upload and analyze your own expression data
** Visualize connections among genes
** Visualize connections among genes
** Learn more special features
** Learn more special features
** Human isoform view
** Human isoform view
** Transcription factor analysis
** Transcription factor analysis
** Downstream effects analysis
** Downstream effects analysis
 
Notes:
* The input data file can be an Excel file with at least one gene ID and expression value at the end of columns (just what BRB-ArrayTools requires in general format importer).
* The data to be '''uploaded''' (because IPA is web-based; the projects/analyses will not be saved locally) can be in different forms. See http://ingenuity.force.com/ipa/articles/Feature_Description/Data-Upload-definitions. It uses the term '''Single/Multiple Observation'''. An Observation is a list of molecule identifiers and their corresponding expression values for a given experimental treatment. A dataset file may contain a single observation or multiple observations. A Single Observation dataset contains only one experimental condition (i.e. wild-type). A Multiple Observation dataset contains more than one experimental condition (i.e. a time course experiment, a dose response experiment, etc) and can be uploaded into IPA in a single file (e.g. Excel). A maximum of 20 observations in a single file may be uploaded into IPA.
* The instruction http://ingenuity.force.com/ipa/articles/Feature_Description/Data-Upload-definitions shows what kind of gene identifier types IPA accepts.
* In this [http://ingenuity.force.com/ipa/articles/Tutorial/upload-analyze-example-data-tutorial prostate example data tutorial], the term 'fold change' was used to replace log2 gene expression. The tutorial also uses 1.5 as the fold change expression cutoff.
* The gene table given on the analysis output contains columns 'Fold change', 'ID', 'Notes', 'Symbol' (with tooltip), 'Entrez Gene Name', 'Location', 'Types', 'Drugs'. See a screenshot below.
 
Screenshots:
 
[[:File:IngenuityAnalysisOutput.png]]
 
== [http://david.abcc.ncifcrf.gov/ DAVID Bioinformatics Resource] ==
It offers an integrated annotation combining gene ontology, pathways and protein annotations.
 
It can be used to identify the pathways associated with a set of genes; e.g. [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-9-412#Sec7 this paper].
 
== GOTrapper ==
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2581-8 GOTrapper: a tool to navigate through branches of gene ontology hierarchy]
 
== [http://cran.r-project.org/web/packages/qpcR/index.html qpcR] ==
Model fitting, optimal model selection and calculation of various features that are essential in the analysis of quantitative real-time polymerase chain reaction (qPCR).
 
== GSEA ==
* http://www.broadinstitute.org/gsea/doc/desktop_tutorial.jsp
* http://www.hmwu.idv.tw/web/CourseSMDA/MADA/Hank_MicroarrayDataAnalysis-GSEA-20110616.pdf
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2716-6#MOESM20 MGSEA]– a multivariate Gene set enrichment analysis


Notes:
== sandbox.bio: Interactive bioinformatics tutorials ==
* The input data file can be an Excel file with at least one gene ID and expression value at the end of columns (just what BRB-ArrayTools requires in general format importer).
https://sandbox.bio/. An interactive playground for learning bioinformatics command-line tools like bedtools, bowtie2, and samtools.
* The data to be '''uploaded''' (because IPA is web-based; the projects/analyses will not be saved locally) can be in different forms. See http://ingenuity.force.com/ipa/articles/Feature_Description/Data-Upload-definitions. It uses the term '''Single/Multiple Observation'''. An Observation is a list of molecule identifiers and their corresponding expression values for a given experimental treatment. A dataset file may contain a single observation or multiple observations. A Single Observation dataset contains only one experimental condition (i.e. wild-type). A Multiple Observation dataset contains more than one experimental condition (i.e. a time course experiment, a dose response experiment, etc) and can be uploaded into IPA in a single file (e.g. Excel). A maximum of 20 observations in a single file may be uploaded into IPA.
* The instruction http://ingenuity.force.com/ipa/articles/Feature_Description/Data-Upload-definitions shows what kind of gene identifier types IPA accepts.
* In this [http://ingenuity.force.com/ipa/articles/Tutorial/upload-analyze-example-data-tutorial prostate example data tutorial], the term 'fold change' was used to replace log2 gene expression. The tutorial also uses 1.5 as the fold change expression cutoff.
* The gene table given on the analysis output contains columns 'Fold change', 'ID', 'Notes', 'Symbol' (with tooltip), 'Entrez Gene Name', 'Location', 'Types', 'Drugs'. See a screenshot below.
 
Screenshots:
 
[[:File:IngenuityAnalysisOutput.png]]
 
== [http://david.abcc.ncifcrf.gov/ DAVID Bioinformatics Resource] ==
It offers an integrated annotation combining gene ontology, pathways and protein annotations.
 
It can be used to identify the pathways associated with a set of genes; e.g. [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-9-412#Sec7 this paper].
 
== GOTrapper ==
[https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2581-8 GOTrapper: a tool to navigate through branches of gene ontology hierarchy]
 
== [http://cran.r-project.org/web/packages/qpcR/index.html qpcR] ==
Model fitting, optimal model selection and calculation of various features that are essential in the analysis of quantitative real-time polymerase chain reaction (qPCR).
 
== GSEA ==
* http://www.broadinstitute.org/gsea/doc/desktop_tutorial.jsp
* http://www.hmwu.idv.tw/web/CourseSMDA/MADA/Hank_MicroarrayDataAnalysis-GSEA-20110616.pdf
* [https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2716-6#MOESM20 MGSEA]– a multivariate Gene set enrichment analysis


= GWAS =
= GWAS =
[https://poissonisfish.wordpress.com/2017/10/09/genome-wide-association-studies-in-r/ Genome-wide association studies in R]
[https://poissonisfish.wordpress.com/2017/10/09/genome-wide-association-studies-in-r/ Genome-wide association studies in R]

Latest revision as of 12:57, 22 January 2026

Visualization

Ten simple rules

Ten simple rules for developing visualization tools in genomics

IGV

nano ~/binary/IGV_2.3.52/igv.sh # Change -Xmx2000m to -Xmx4000m in order to increase the memory to 4GB
~/binary/IGV_2.3.52/igv.sh

Simulated DNA-Seq

The following shows 3 simulated DNA-Seq data; the top has 8 insertions (purple '|') per read, the middle has 8 deletions (black '-') per read and the bottom has 8 snps per read.

File:Igv dna simul.png

Whole genome

PRJEB1486

File:Igv prjeb1486 wgs.png

Whole exome

  • (Left) GSE48215, UCSC hg19. It is seen there is a good coverage on all exons.
  • (Right) 1 of 3 whole exome data from SRP066363, UCSC hg19.

File:Igv gse48215.png File:Igv srp066363.png

RNA-Seq

  • (Left) Anders2013, Drosophila_melanogaster/Ensembl/BDGP5. It is seen there are no coverages on some exons.
  • (Right) GSE46876, UCSC/hg19.

File:Igv anders2013 rna.png File:Igv gse46876 rna.png

Tell DNA or RNA

  • DNA: no matter it is whole genome or whole exome, the coverage is more even. For whole exome, there is no splicing.
  • RNA: focusing on expression so the coverage changes a lot. The base name still A,C,G,T (not A,C,G,U).

ChromoMap

ChromoMap: an R package for interactive visualization of multi-omics data and annotation of chromosomes

RNA-seq DRaMA

https://hssgenomics.shinyapps.io/RNAseq_DRaMA/ from 2nd Annual Shiny Contest

Gviz

GIVE: Genomic Interactive Visualization Engine

Build your own genome browser

ChromHeatMap

Heat map plotting by genome coordinate.

ggbio

Wondering how to look at the reads of a gene in samples to check if it was knocked out?

NOISeq package

Exploratory analysis (Sequencing depth, GC content bias, RNA composition) and differential expression for RNA-seq data.

rtracklayer

R interface to genome browsers and their annotation tracks

  • Retrieve annotation from GTF file and parse the file to a GRanges instance. See the 'Counting reads with summarizeOverlaps' vignette from GenomicAlignments package.

ssviz

A small RNA-seq visualizer and analysis toolkit. It includes a function to draw bar plot of counts per million in tag length with two datasets (control and treatment).

Sushi

See fig on p22 of Sushi vignette where genes with different strands are shown with different directions when plotGenes() was used. plotGenes() can be used to plot gene structures that are stored in bed format.

cBioPortal, TCGA, PanCanAtlas

See TCGA.

TCPA

Download. Level 4.

Qualimap

Qualimap 2 is a platform-independent application written in Java and R that provides both a Graphical User Inteface (GUI) and a command-line interface to facilitate the quality control of alignment sequencing data and its derivatives like feature counts.

SeqMonk

SeqMonk is a program to enable the visualisation and analysis of mapped sequence data.

dittoSeq

dittoSeq – universal user-friendly single-cell and bulk RNA sequencing visualization toolkit, bioinformatics

SeqCVIBE

SeqCVIBE – interactive analysis, exploration, and visualization of RNA-Seq data

ggcoverage

ggcoverage: an R package to visualize and annotate genome coverage for various NGS data 2023

Copy Number

Copy number work flow using Bioconductor

Detect copy number variation (CNV) from the whole exome sequencing

CNVkit

Whole exome sequencing != whole genome sequencing

Consensus CDS/CCDS

DBS segmentation algorithm

DBS: a fast and informative segmentation algorithm for DNA copy number analysis

modSaRa2

An accurate and powerful method for copy number variation detection

Visualization

reconCNV: interactive visualization of copy number data from high-throughput sequencing 2021

NGS

File:CentralDogmaMolecular.png

See NGS.

mNGS

找出病原菌的新武器 :總基因體次世代定序是什麼?

R and Bioconductor packages

Resources

library(VariantAnnotation)
library(AnnotationHub)
library(TxDb.Hsapiens.UCSC.hg19.knownGene)
library(TxDb.Mmusculus.UCSC.mm10.ensGene)
library(org.Hs.eg.db)
library(org.Mm.eg.db)
library(BSgenome.Hsapiens.UCSC.hg19)

Docker

Bioinstaller: A comprehensive R package to construct interactive and reproducible biological data analysis applications based on the R platform. Package on CRAN.

Some workflows

RNA-Seq workflow

Gene-level exploratory analysis and differential expression. A non stranded-specific and paired-end rna-seq experiment was used for the tutorial.

       STAR       Samtools         Rsamtools
fastq -----> sam ----------> bam  ----------> bamfiles  -|
                                                          \  GenomicAlignments       DESeq2 
                                                           --------------------> se --------> dds
      GenomicFeatures         GenomicFeatures             /        (SummarizedExperiment) (DESeqDataSet)
  gtf ----------------> txdb ---------------> genes -----|

rnaseqGene

rnaseqGene - RNA-seq workflow: gene-level exploratory analysis and differential expression

tximport

CodeOcean - Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences (version: 1.17.5). Plan.

Sequence analysis

library(ShortRead) or library(Biostrings) (QA)
gtf + library(GenomicFeatures) or directly library(TxDb.Scerevisiae.UCSC.sacCer2.sgdGene) (gene information)
GenomicRanges::summarizeOverlaps or GenomicRanges::countOverlaps(count)
edgeR or DESeq2 (gene expression analysis)
library(org.Sc.sgd.db) or library(biomaRt)

Accessing Annotation Data

Use microarray probe, gene, pathway, gene ontology, homology and other annotations. Access GO, KEGG, NCBI, Biomart, UCSC, vendor, and other sources.

library(org.Hs.eg.db)  # Sample OrgDb Workflow
library("hgu95av2.db") # Sample ChipDb Workflow
library(TxDb.Hsapiens.UCSC.hg19.knownGene) # Sample TxDb Workflow
library(Homo.sapiens)  # Sample OrganismDb Workflow
library(AnnotationHub) # Sample AnnotationHub Workflow
library("biomaRt")     # Using biomaRt
library(BSgenome.Hsapiens.UCSC.hg19) # BSgenome packages
Object type example package name contents
OrgDb org.Hs.eg.db gene based information for Homo sapiens
TxDb TxDb.Hsapiens.UCSC.hg19.knownGene transcriptome ranges for Homo sapiens
OrganismDb Homo.sapiens composite information for Homo sapiens
BSgenome BSgenome.Hsapiens.UCSC.hg19 genome sequence for Homo sapiens
refGenome

RNA-Seq Data Analysis using R/Bioconductor

recount2

recount3

  • Intro RNA-seq LCG-UNAM 2022 (Spanish)
  • Recount3: PCR duplicates.
    • PCR duplication can refer to two different things. It can mean the process of making many copies of a specific DNA region using a technique called Polymerase Chain Reaction (PCR). PCR relies on a thermostable DNA polymerase and requires DNA primers designed specifically for the DNA region of interest.
    • On the other hand, PCR duplication can also refer to a problem that occurs when the same DNA fragment is amplified and sequenced multiple times, resulting in identical reads that can bias many types of high-throughput-sequencing experiments. These identical reads are called PCR duplicates and can be eliminated using various methods such as removing all but one read of identical sequences or using unique molecular identifiers (UMIs) to enable accurate counting and tracking of molecules.
    • UMI stands for Unique Molecular Identifier. It is a complex index added to sequencing libraries before any PCR amplification steps, enabling the accurate bioinformatic identification of PCR duplicates. UMIs are also known as Molecular Barcodes or Random Barcodes. UMIs are valuable tools for both quantitative sequencing applications and also for genomic variant detection, especially the detection of rare mutations. UMI sequence information in conjunction with alignment coordinates enables grouping of sequencing data into read families representing individual sample DNA or RNA fragments.
    • dedup - Deduplicate reads using UMI and mapping coordinates
    • UMIs can be extracted from a fastq file using awk. For example awk 'NR % 4 == 1 {split($0,a,":"); print a[6]}' input.fastq > umis.txt . Here we assume the read header is @SEQ_ID:LANE:TILE:X:Y:UMI, then the UMI sequence is in the 6th field, following the 5th colon.

dbGap

dbgap2x: an R package to explore and extract data from the database of Genotypes and Phenotypes (dbGaP)

eQTL

Statistics for Genomic Data Science (Coursera) and MatrixEQTL from CRAN

GenomicDataCommons package

Note:

  1. The TCGA data such as TCGA-LUAD are not part of clinical trials (described here).
  2. Each patient has 4 categories data and the 'case_id' is common to them:
    • demographic: gender, race, year_of_birth, year_of_death
    • diagnoses: tumor_stage, age_at_diagnosis, tumor_grade
    • exposures: cigarettes_per_day, alcohol_history, years_smoked, bmi, alcohol_intensity, weight, height
    • main: disease_type, primary_site
  3. The original download (clinical.tsv file) data contains a column 'treatment_or_therapy' but it has missing values for all patients.

Visualization

GenVisR

ComplexHeatmap

Read counts

Read, fragment

  • Meaning of the "reads" keyword in terms of RNA-seq or next generation sequencing. A read refers to the sequence of a cluster that is obtained after the end of the sequencing process which is ultimately the sequence of a section of a unique fragment.
  • What is the difference between a Read and a Fragment in RNA-seq?. Diagram , Pair-end, single-end.
  • In the context of RNA-seq, "read" and "fragment" may refer to slightly different things, but they are related concepts.
    • A read is a short sequence of nucleotides that has been generated by a sequencing machine. These reads are typically around 100-150 bases long. RNA-seq experiments generate millions or billions of reads, and these reads are aligned to a reference genome or transcriptome to determine which reads came from which genes or transcripts, this information is used to quantify gene and transcript expression levels.
    • A fragment is a piece of RNA that has been broken up and converted into a read. In RNA-seq, the first step is to convert the RNA into a library of fragments. To do this, the RNA is typically broken up into smaller pieces using a process called fragmentation. Then, adapters are added to the ends of the fragments to allow them to be sequenced. The fragments are then converted into a library of reads that can be sequenced using a next-generation sequencing platform.
    • In summary, a read is a short sequence of nucleotides that has been generated by a sequencing machine, whereas a fragment is a piece of RNA that has been broken up and converted into a read. The process of fragmentation creates a library of fragments that are then converted into reads that can be sequenced.
  • Does one fragment contain 1 read or multiple reads?
    • One fragment in RNA-seq can contain multiple reads, depending on the sequencing technology and library preparation protocol used.
    • In the process of library preparation, RNA is first fragmented into smaller pieces, then adapters are ligated to the ends of the fragments. The fragments are then amplified using PCR, generating multiple copies of the original fragment. These amplified fragments are then sequenced using a next-generation sequencing platform, generating multiple reads per fragment.
    • For example, in Illumina sequencing, fragments are ligated with adapters, then they are clonally amplified using bridge amplification. This allows for the creation of clusters of identical copies of the original fragment on a sequencing flow cell. Then, each cluster is sequenced, generating a large number of reads per fragment.
    • In other technologies like PacBio or Nanopore, the sequencing of a fragment generates only one read, as the technology can read long stretches of DNA, therefore it doesn't need to fragment the RNA prior to sequencing.
    • In summary, one fragment in RNA-seq can contain multiple reads, depending on the sequencing technology and library preparation protocol used. The number of reads per fragment can vary from one to several thousands.
  • How many reads in a fragment on average in illumination sequencing?
    • The number of reads per fragment in Illumina sequencing can vary depending on the sequencing platform and library preparation protocol used, as well as the sequencing depth and the complexity of the sample. However, on average, one fragment can generate several hundred to several thousand reads in Illumina sequencing.
    • When sequencing is performed on the Illumina platform, the process of library preparation includes fragmenting the RNA into smaller pieces, ligating adapters to the ends of the fragments, and then amplifying the fragments using bridge amplification. This allows for the creation of clusters of identical copies of the original fragment on a sequencing flow cell. Then, each cluster is sequenced, generating multiple reads per fragment.
    • The number of reads per fragment can also be affected by the sequencing depth, which refers to the total number of reads generated by the sequencing machine. A higher sequencing depth will result in more reads per fragment, while a lower sequencing depth will result in fewer reads per fragment.
    • In summary, the number of reads per fragment in Illumina sequencing can vary, but on average, one fragment can generate several hundred to several thousand reads. The number of reads per fragment can be influenced by the sequencing platform, library preparation protocol, sequencing depth, and the complexity of the sample.

Rsubread

RSEM

  • RSEM, rsem-calculate-expression
  • RSEM on Biowulf
    $ mkdir SeqTestdata/RNASeqFibroblast/output
    $ sinteractive --cpus-per-task=2 --mem=10g
    $ module load rsem bowtie STAR
    $ rsem-calculate-expression -p 2 --paired-end --star \
    				../test.SRR493366_1.fastq ../test.SRR493366_2.fastq \
    				/fdb/rsem/ref_from_genome/hg19 Sample1 # 12 seconds
    				
    $ ls -lthog
    total 5.8M
    -rw-r----- 1 1.6M Nov 24 13:39 Sample1.genes.results
    -rw-r----- 1 2.5M Nov 24 13:39 Sample1.isoforms.results
    -rw-r----- 1 1.6M Nov 24 13:39 Sample1.transcript.bam
    drwxr-x--- 2 4.0K Nov 24 13:39 Sample1.stat
    
    $ wc -l Sample1.genes.results
    26335 Sample1.genes.results
    $ wc -l Sample1.isoforms.results
    51399 Sample1.isoforms.results
    
    $ head -2 Sample1.genes.results
    gene_id	transcript_id(s)	length	effective_length	expected_count	TPM	FPKM
    A1BG	NM_130786	1766.00	1589.99	0.00	0.00	0.00
    $ head -2 Sample1.isoforms.results
    transcript_id	gene_id	length	effective_length	expected_count	TPM	FPKM	IsoPct
    NM_130786	A1BG	1766	1589.99	0.00	0.00	0.00	0.00
    $ head -1 /fdb/rsem/ref_from_genome/hg19.transcripts.fa
    >NM_130786
    $ grep NM_130786 /fdb/igenomes/Homo_sapiens/UCSC/hg19/transcriptInfo.tab
    NM_130786	2721192635	2721199328	2721188175	2	8	431185
  • RSEM gene level result file (see here for an example) contains 5 essential columns (and the element saved by tximport() function) excluding transcript_id
    • Effective length → length. This is different across samples. This is much shorter than Length (e.g. 105 vs 1).
    • Expected count → count. This is the sum of the posterior probability of each read comes from this transcript over all reads.
    • TPM → abundance. The sum of all transcripts' TPM is 1 million.
    • FPKM (not kept?). FPKM_i = 10^3 / l_bar * TPM_i for gene i. So for each sample FPKM is a scaling of TPM.
    R> dfpkm[1:5, 1:3] / txi.rsem$abundance[1:5, 1:3]
              144126_210-T_JKQFX5 144126_210-T_JKQFX6 144126_210-T_JKQFX8
    5S_rRNA             0.7563603            1.118008           0.8485292
    5_8S_rRNA                 NaN                 NaN                 NaN
    6M1-18                    NaN                 NaN                 NaN
    7M1-2                     NaN                 NaN                 NaN
    7SK                 0.7563751            1.118029           0.8485281
    
  • An example using tximport::tximport() and DESeq2::DESeqDataSetFromTximport. Note it directly uses round(expected_count) to get the integer-value counts. See the source of DESeqDataSetFromTximport() here. The tximport vignette has discussed two suggested ways of importing estimates for use with differential gene expression (DGE) methods in the section of "Downstream DGE in Bioconductor". The vignette does not say anything about "expected_count" from RSEM output.
    txi.rsem <- tximport(files, type = "rsem", txIn = F, txOut = F)
    txi.rsem$length[txi.rsem$length == 0] <- 1
    names(txi.rsem) # a list, 
                    # length = effective_length (matrix)
                    # counts = expected counts column (matrix), non-integer
                    # abundance = TPM (matrix)
                    # countsFromAbundance = "no"
    # [1] "abundance"           "counts"              "length"             
    # [4] "countsFromAbundance"
    
    sampleTable <- pheno[, c("EXPID", "PatientID")]
    rownames(sampleTable) <- colnames(txi.rsem$counts)
    
    dds <- DESeq2::DESeqDataSetFromTximport(txi.rsem, sampleTable, ~ PatientID)
    # using counts and average transcript lengths from tximport
    # 
    # The DESeqDataSet class enforces non-negative integer values in the "counts" 
    #     matrix stored as the first element in the assay list.
    dds@assays@data@listData$counts[1:5, 1:3] # integer values. How to compute?
                                   # https://support.bioconductor.org/p/9134840/
    dds@assays@data@listData$avgTxLength[1:5, 1:3] # effective_length
    
    plot(txi.rsem$counts[,1], dds@assays@data@listData$counts[,1])
    abline(0, 1, col = 'red')      # compare expected counts vs integer-value counts
                                   # a straight line
    
    ddsColl1 <- DESeq2::estimateSizeFactors(dds)
    # using 'avgTxLength' from assays(dds), correcting for library size
    # Question: how does the function correct for library size?
    
    ddsColl2 <- DESeq2::estimateDispersions(ddsColl1)
    # gene-wise dispersion estimates
    # mean-dispersion relationship
    # final dispersion estimates
    # Note: it seems estimateDispersions is not required 
    #       if we only want to get the normalized count (still need estimateSizeFactors())
    # See ArrayTools/R/FilterAndNormalize.R
    
    cnts2 <- DESeq2::counts(ddsColl2, normalized = FALSE)
    all(dds@assays@data@listData$counts == cnts2)
    # [1] TRUE
    
    all(round(txi.rsem$counts) == cnts2 )
    # [1] TRUE.     So in this case round(expected values) = integer-value counts
    
  • RSEM example on Odyssey
  • A Short Tutorial for RSEM
  • Hands-on Training in RNA-Seq Data Analysis* which includes Quantification using RSEM and Perform DE analysis. Note the expected count column was used in edgeR.
  • Understanding RSEM: raw read counts vs expected counts. These “expected counts” can then be provided as a matrix (rows = mRNAs, columns = samples) to programs such as EBSeq, DESeq, or edgeR to identify differentially expressed genes.
  • RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. Abundance estimates are given in terms of two measures. The output file (XXX_RNASeq.RSEM.genes.results) contains 7 columns: gene_id, transcript_id(s), length, effective_length, expected_count, TPM, FPKM.
    • Expected counts: The is an estimate of the number of fragments that are derived from a given isoform or gene. This count is generally a non-integer value and is the expectation of the number of alignable and unfiltered fragments that are derived from a isoform or gene given the ML abundances. These (possibly rounded) counts may be used by a differential expression method such as edgeR or DESeq.
    • TPM: This is the estimated fraction of transcripts made up by a given isoform or gene. The transcript fraction measure is preferred over the popular RPKM/FPKM measures because it is independent of the mean expressed transcript length and is thus more comparable across samples and species.
  • The length or effective_length are different (though similar) for different samples for the same gene
  • A scatter plot and correlation shows the expected_count and TPM are different
    x <- read.delim("144126_210-T_JKQFX5_v2.0.1.4.0_RNASeq.RSEM.genes.results")
    colnames(x)
    # [1] "gene_id"          "transcript_id.s." "length"           "effective_length"
    # [5] "expected_count"   "TPM"              "FPKM" 
    plot(x[, "TPM"], x[, "expected_count"])
    cor(x[, "TPM"], x[, "expected_count"])
    # [1] 0.4902708
    cor(x[, "TPM"], x[, "expected_count"], method = 'spearman')
    # [1] 0.9886384
    x[1:5, "length"]
    [1] 105.01 161.00 473.00  68.00 304.47
    
    x2 <- read.delim("144126_210-T_JKQFX6_v2.0.1.4.0_RNASeq.RSEM.genes.results")
    x2[1:5, "length"]
    # [1] 105.00 161.00 473.00  68.00 305.27
    x[1:5, "effective_length"]
    # [1]   1.03  16.65 293.88   0.00 129.00
    x2[1:5, "effective_length"]
    # [1]   1.58  17.82 293.05   0.00 128.86
    
  • A benchmark for RNA-seq quantification pipelines. 2016 They compare the STAR, TopHat2, and Bowtie2 mapping methods and the Cufflinks, eXpress , Flux Capacitor, kallisto, RSEM, Sailfish, and Salmon quantification methods. RSEM slightly outperforming the rest.
  • Downsample reads from Evaluation of Cell Type Annotation R Packages on Single Cell RNA-seq Data 2020.

Expected_count

Number of reads mapping to that transcript

  • Understanding RSEM: raw read counts vs expected counts In the ideal case, the expected count estimated by RSEM will be precisely the number of reads mapping to that transcript. However, when counting the number of reads mapped for all transcripts, multireads get counted multiple times, so we can expect that this number will be slightly larger than the expected count for many transcripts.
    R> x <- read.delim("41samples/165739~295-R~AM1I30~RNASEQ.genes.results")
    R> summary(x$expected_count)     # Larger than TPM, contradict to the above statement
       Min. 1st Qu.  Median    Mean 3rd Qu.    Max.
          0       0      10    1346     556  533634
    R> summary(x$TPM)
        Min.  1st Qu.   Median     Mean  3rd Qu.     Max.
        0.00     0.00     0.16    35.58     7.50 70091.93
    R> x[1:5, c("expected_count", "TPM")]
      expected_count      TPM
    1        6190.00 70091.93
    2           0.00     0.00
    3           0.00     0.00
    4           0.00     0.00
    5         795.01   171.67
    
  • Expected counts from RSEM in DESeq2? Yes, RSEM expected counts can be used with DESeq2. Don't use TPM or FPKM because they are already normalized. It seems there is no need to do rounding before calling the tximport() function.
    # adding
    txi$length[txi$length <= 0] <- 1
    # before
    dds <- DESeqDataSetFromTximport(txi, sampleTable, ~condition)
  • Alignment-based的转录本定量-RSEM/ the sum of the posterior probability of each read comes from this transcript over all reads

Examples

$ wc -l 144126_210-T_JKQFX5_v2.0.1.4.0_RNASeq.RSEM.genes.results
   28110 144126_210-T_JKQFX5_v2.0.1.4.0_RNASeq.RSEM.genes.results

$ head -n 4 144126_210-T_JKQFX5_v2.0.1.4.0_RNASeq.RSEM.genes.results | cut -f1,3,4,5,6,7

gene_id	  length  effective_length  expected_count TPM	   FPKM
5S_rRNA	  105.01  1.03	            1513.66	   31450.7 23788.06
5_8S_rRNA 161	  16.65	            0	           0	   0
6M1-18	  473	  293.88	    0	           0	   0

Second example

$ wc -l Sample_HS-578T_CB6CRANXX.genes.results
28110
$ head -1 Sample_HS-578T_CB6CRANXX.genes.results
gene_id	transcript_id.s.	length	effective_length	expected_count	TPM	FPKM
$ tail -4Sample_HS-578T_CB6CRANXX.genes.results
septin 9/TNRC6C fusion	uc010wto.1	41	0	0	0	0
svRNAa	uc022bxg.1	22	0	0	0	0
tRNA Pro	uc022bqx.1	65	0	0	0	0
unknown	uc002afm.3	1117	922.85	0	0	0

$ wc -l Sample_HS-578T_CB6CRANXX.isoforms.results
78376
$ head -1 Sample_HS-578T_CB6CRANXX.isoforms.results
transcript_id	gene_id	length	effective_length	expected_count	TPM	FPKM	IsoPct
$ tail -4 Sample_HS-578T_CB6CRANXX.isoforms.results
uc010wto.1	septin 9/TNRC6C fusion	41	0	0	0	0	0
uc022bxg.1	svRNAa	22	0	0	0	0	0
uc022bqx.1	tRNA Pro	65	0	0	0	0	0
uc002afm.3	unknown	1117	922.85	0	0	0	0

limma

  • Differential expression analyses for RNA-sequencing and microarray studies
  • Case Study using a Bioconductor R pipeline to analyze RNA-seq data (this is linked from limma package user guide). Here we illustrate how to use two Bioconductor packages - Rsubread' and limma - to perform a complete RNA-seq analysis, including Subread'Bold text read mapping, featureCounts read summarization, voom normalization and limma differential expresssion analysis.
  • Unbalanced data, non-normal data, Bartlett's test for equal variance across groups and SAM tests (assumes equal variances just like limma). See this post.

B-statistic

  • The “B value” in limma is named after the Bayesian framework used to compute it.
  • B = Bayesian log-odds of differential expression
  • B value → Bayesian belief that the gene is truly DE. Higher B value → stronger evidence the gene is differentially expressed.
    • B = 0 → odds are 1:1 → 50% probability of differential expression
    • B > 0 → more likely DE than not
    • B < 0 → less likely DE
  • For each gene, it estimates: B = Prob(DE) / (1-Prob(DE))
  • Prob(DE) <- exp(B) / (1 + exp(B))

RSEM

TMM (Robinson and Oshlack, 2010)

Trimmed Means of M values (edgeR).

  • TMM relies on the assumption that most genes are not differentially expressed. See the paper. DESeq2 does not rely on this assumption.
  • TMM will not work well for samples where the library size is so small that most of the counts become zero. A library size of 1 million is on the small side, but is probably ok. Is there any reason to think that normalization (e.g. TMM) doesn't work well with samples that that have very different raw counts?
  • Many normalization RNA-Seq normalization methods perform poorly on samples with extreme composition bias. For instance, in one sample a large number of reads comes from rRNAs while in another they have been removed more efficiently. Most scaling based methods, including RPKM and CPM, will underestimate the expression of weaker expressed genes in the presence of extremely abundant mRNAs (less sequencing real estate available for them). The TMM methods tries to correct this bias.
  • Does EdgeR trimmed mean of M values (TMM) account for gene length? No. In general, edgeR does not need to adjust for gene length in DE analyses because gene length cancels out of DE comparisons.
  • Gene expression units explained: RPM, RPKM, FPKM, TPM, DESeq, TMM, SCnorm, GeTMM, and ComBat-Seq
  • Q: Does TMM method require count data?
    • A: Yes, the TMM method requires RNA-seq count data as input.
    • The TMM method uses these count data to calculate the scaling factors that adjust for differences in library size and gene length, as well as the effects of highly expressed genes.
    • Before applying the TMM method, it is important to ensure that the count data has been properly preprocessed and filtered to remove low-quality reads, adapter sequences, and other artifacts.
  • Q: can TMM method be applied to non-integer data?
    • A: It is possible to apply TMM to non-integer data, such as normalized expression values or FPKM (fragments per kilobase of transcript per million mapped reads) values, by rounding the values to the nearest integer.
    • In practice, the TMM method can be applied to non-integer data by first converting the data to counts, for example, by multiplying the expression values by a scaling factor that represents the average library size, and then rounding the resulting values to the nearest integer. The TMM method can then be applied to the rounded count data as usual.
  • StatQuest: edgeR, part 1, Library Normalization. Good explanation about reference sample selection.
  • Trimmed Mean
  • RNA Sequence Analysis in R: edgeR
  • Normalisation methods implemented in edgeR. TMM, RLE, Upper-quartile.
  • Using edgeR package
    library(magrittr)
    library(edgeR)
    set.seed(1)
    M <- matrix(rnbinom(10000,mu=5,size=2), ncol=4)
    
    out <- DGEList(M) %>% calcNormFactors() %>% cpm()
    
  • Using NOISeq package
    library(NOISeq)
    out2 <- tmm(M, long = 1000, lc = 0, k = 0)
    out[1:3, 1:3] / out2[1:3, 1:3]
    #    Sample1  Sample2  Sample3
    # 1 80.81611 81.32609      NaN
    # 2 80.81611 81.32609 80.81611
    # 3 80.81611      NaN 80.81611
    

TMM + voom (+ lmFit)

Toy data with replication

  • Toy counts with replication
    library(edgeR)
    library(limma)
    
    counts <- matrix(c(
      10, 12, 100, 120,
      20, 25, 2000, 1800,
      30, 28, 300, 310
    ), nrow=3, byrow=TRUE)
    rownames(counts) <- paste0("Gene", 1:3)
    colnames(counts) <- paste0("Sample", 1:4)
    counts
    #       Sample1 Sample2 Sample3 Sample4
    # Gene1      10      12     100     120
    # Gene2      20      25    2000    1800
    # Gene3      30      28     300     310
    
  • TMM: correct for composition bias (output is still on counts level)
    dge <- DGEList(counts=counts)
    dge <- calcNormFactors(dge, method="TMM")   # TMM normalization
    dge$samples
    #         group lib.size norm.factors
    # Sample1     1       60    1.3544704
    # Sample2     1       65    1.3311779
    # Sample3     1     2400    0.7175709
    # Sample4     1     2230    0.7729112
    
  • Make design matrix
    group <- factor(c("A","A","B","B"))
    design <- model.matrix(~group)
    design
    #   (Intercept) groupB
    # 1           1      0
    # 2           1      0
    # 3           1      1
    # 4           1      1
    
  • Run voom (calculate log2CPM + weights for lmFit in the next step)
    v <- voom(dge, design, plot=TRUE)
    # x-axis = mean log2(CPM) for each gene across all samples
    # y-axis = square root of the residual variance for each gene
    

    The plot is very close to the following except shift/scaling. Three points are generated.

    x <- rowMeans(v$E)
    
    # y = residual standard deviation per gene
    fit <- lmFit(v$E, design)
    residuals <- v$E - fit$coef %*% t(design)  # or residuals(fit)
    y <- apply(residuals, 1, sd)
    
    # now you have the points for the voom plot
    plot(x, y)
    
  • Inspect TMM+voom expression matrix. Note the weight matrix are almost sample dependent.
    names(v)
    # [1] "targets" "E"       "weights" "design" 
    v$E        # log2 CPMs after TMM
    #        Sample1  Sample2  Sample3  Sample4
    # Gene1 16.96162 17.12378 15.83177 16.09242
    # Gene2 17.92686 18.15234 20.14686 19.99371
    # Gene3 18.50004 18.31281 17.41194 17.45798
    v$weights  # precision weights
    #          [,1]     [,2]     [,3]     [,4]
    # [1,] 42.44895 42.44895 93.58325 93.51160
    # [2,] 42.44895 42.44895 53.83541 53.83541
    # [3,] 42.44895 42.44895 53.83541 53.83541
    

    Note that 1) samples 1 and 2 have lower counts -> they have lower weights, and 2) voom computes precision weights for each observation (gene × sample) based on how far a particular sample’s residual is from the trend.

    Verify log2(CPM). Method 1: use cpm()

    logCPM <- cpm(dge, log=TRUE, prior.count=1) # prior.count avoids log(0)
    logCPM
    #        Sample1  Sample2  Sample3  Sample4
    # Gene1 16.91861 17.08974 15.84947 16.10682
    # Gene2 17.91216 18.14268 20.14552 19.99249
    # Gene3 18.49497 18.30559 17.41632 17.46215
    

    Verify log2(CPM). Method 2: by hand (effective library size per sample)

    # effective library size per sample (vector)
    eff.libsize <- dge$samples$lib.size * dge$samples$norm.factors
    
    # compute CPM manually: divide each column of counts by corresponding eff.libsize
    cpm_manual <- sweep(counts, 2, eff.libsize, "/") * 1e6
    
    # log2 CPM with prior.count = 1
    log2CPM_manual <- log2(cpm_manual + 1)
    log2CPM_manual
    #        Sample1  Sample2  Sample3  Sample4
    # Gene1 16.90889 17.08147 15.82544 16.08728
    # Gene2 17.90888 18.14036 20.14734 19.99415
    # Gene3 18.49384 18.30386 17.41038 17.45650
    
  • Next step: DE analysis
    fit <- lmFit(v, design)
    fit <- eBayes(fit)
    topTable(fit, coef="groupB")
    #            logFC  AveExpr         t      P.Value    adj.P.Val        B
    # Gene2  2.0306865 19.05494 13.711164 9.354653e-06 2.806396e-05 86.19536
    # Gene1 -1.0806544 16.50240 -8.093091 1.908026e-04 2.862040e-04 25.02757
    # Gene3 -0.9714666 17.92069 -6.559327 6.012746e-04 6.012746e-04 13.90828
    

Within-subject correlation

  • Does this RNAseq experiment require a repeated measures approach?
    • Solution 1: 9.7 Multi-level Experiments of LIMMA user guide. duplicateCorrelation(), lmFit(), makeContrasts(), contrasts.fit() and eBayes()
    • Solution 2: Section 3.5 "Comparisons both between and within subjects" in edgeR. model.matrix(), glmQLFit(), glmQLFTtest(), topTags().

Time Course Experiments

  • See Limma's vignette on Section 9.6
    • Few time points (ANOVA, contrast)
      • Which genes respond at either the 6 hour or 24 hour times in the wild-type?
      • Which genes respond (i.e., change over time) in the mutant?
      • Which genes respond differently over time in the mutant relative to the wild-type?
    • Many time points (regression such as cubic spline, moderated F-test)
      • Detect genes with different time trends for treatment vs control.

easyRNASeq

Calculates the coverage of high-throughput short-reads against a genome of reference and summarizes it per feature of interest (e.g. exon, gene, transcript). The data can be normalized as 'RPKM' or by the 'DESeq' or 'edgeR' package.

ShortRead

Base classes, functions, and methods for representation of high-throughput, short-read sequencing data.

Rsamtools

The Rsamtools package provides an interface to BAM files.

The main purpose of the Rsamtools package is to import BAM files into R. Rsamtools also provides some facility for file access such as record counting, index file creation, and filtering to create new files containing subsets of the original. An important use case for Rsamtools is as a starting point for creating R objects suitable for a diversity of work flows, e.g., AlignedRead objects in the ShortRead package (for quality assessment and read manipulation), or GAlignments objects in GenomicAlignments package (for RNA-seq and other applications). Those desiring more functionality are encouraged to explore samtools and related software efforts

This package provides an interface to the 'samtools', 'bcftools', and 'tabix' utilities (see 'LICENCE') for manipulating SAM (Sequence Alignment / Map), FASTA, binary variant call (BCF) and compressed indexed tab-delimited (tabix) files.

IRanges

IRanges is a fundamental package (see how many packages depend on it) to other packages like GenomicRanges, GenomicFeatures and GenomicAlignments. The package defines the IRanges class.

The plotRanges() function given in the 'An Introduction to IRanges' vignette shows how to draw an IRanges object.

If we want to make the same plot using the ggplot2 package, we can follow the example in this post. Note that disjointBins() returns a vector the bin number for each bins counting on the y-axis.

flank

The example is obtained from ?IRanges::flank.

ir3 <- IRanges(c(2,5,1), c(3,7,3))
# IRanges of length 3
#     start end width
# [1]     2   3     2
# [2]     5   7     3
# [3]     1   3     3

flank(ir3, 2)
#     start end width
# [1]     0   1     2
# [2]     3   4     2
# [3]    -1   0     2
# Note: by default flank(ir3, 2) = flank(ir3, 2, start = TRUE, both=FALSE)
# For example, [2,3] => [2,X] => (..., 0, 1, 2) => [0, 1]
#                                     == ==

flank(ir3, 2, start=FALSE)
#     start end width
# [1]     4   5     2
# [2]     8   9     2
# [3]     4   5     2
# For example, [2,3] => [X,3] => (..., 3, 4, 5) => [4,5]
#                                        == == 

flank(ir3, 2, start=c(FALSE, TRUE, FALSE))
#     start end width
# [1]     4   5     2
# [2]     3   4     2
# [3]     4   5     2
# Combine the ideas of the previous 2 cases.

flank(ir3, c(2, -2, 2))
#     start end width
# [1]     0   1     2
# [2]     5   6     2
# [3]    -1   0     2
# The original statement is the same as flank(ir3, c(2, -2, 2), start=T, both=F)
# For example, [5, 7] => [5, X] => ( 5, 6) => [5, 6]
#                                   == ==

flank(ir3, -2, start=F)
#     start end width
# [1]     2   3     2
# [2]     6   7     2
# [3]     2   3     2
# For example, [5, 7] => [X, 7] => (..., 6, 7) => [6, 7]
#                                       == ==

flank(ir3, 2, both = TRUE)
#     start end width
# [1]     0   3     4
# [2]     3   6     4
# [3]    -1   2     4
# The original statement is equivalent to flank(ir3, 2, start=T, both=T)
# (From the manual) If both = TRUE, extends the flanking region width positions into the range. 
#        The resulting range thus straddles the end point, with width positions on either side.
# For example, [2, 3] => [2, X] => (..., 0, 1, 2, 3) => [0, 3]
#                                             ==
#                                       == == == ==

flank(ir3, 2, start=FALSE, both=TRUE)
#     start end width
# [1]     2   5     4
# [2]     6   9     4
# [3]     2   5     4
# For example, [2, 3] => [X, 3] => (..., 2, 3, 4, 5) => [4, 5]
#                                          ==
#                                       == == == ==

Both IRanges and GenomicRanges packages provide the flank function.

Flanking region is also a common term in High-throughput sequencing. The IGV user guide also has some option related to flanking.

  • General tab: Feature flanking regions (base pairs). IGV adds the flank before and after a feature locus when you zoom to a feature, or when you view gene/loci lists in multiple panels.
  • Alignments tab: Splice junction track options. The minimum amount of nucleotide coverage required on both sides of a junction for a read to be associated with the junction. This affects the coverage of displayed junctions, and the display of junctions covered only by reads with small flanking regions.

Biostrings

GenomicRanges

GenomicRanges depends on IRanges package. See the dependency diagram below.

GenomicFeatues ------- GenomicRanges -+- IRanges -- BioGenomics
                         |            +
                   +-----+            +- GenomeInfoDb
                   |                      |
GenomicAlignments  +--- Rsamtools --+-----+
                                    +--- Biostrings

The package defines some classes

  • GRanges
  • GRangesList
  • GAlignments
  • SummarizedExperiment: it has the following slots - expData, rowData, colData, and assays. Accessors include assays(), assay(), colData(), expData(), mcols(), ... The mcols() method is defined in the S4Vectors package.

(As of Jan 6, 2015) The introduction in GenomicRanges vignette mentions the GAlignments object created from a 'BAM' file discarding some information such as SEQ field, QNAME field, QUAL, MAPQ and any other information that is not needed in its document. This means that multi-reads don't receive any special treatment. Also pair-end reads will be treated as single-end reads and the pairing information will be lost. This might change in the future.

GenomicAlignments

Counting reads with summarizeOverlaps vignette

library(GenomicAlignments)
library(DESeq)
library(edgeR)

fls <- list.files(system.file("extdata", package="GenomicAlignments"),
    recursive=TRUE, pattern="*bam$", full=TRUE)

features <- GRanges(
    seqnames = c(rep("chr2L", 4), rep("chr2R", 5), rep("chr3L", 2)),
    ranges = IRanges(c(1000, 3000, 4000, 7000, 2000, 3000, 3600, 4000, 
        7500, 5000, 5400), width=c(rep(500, 3), 600, 900, 500, 300, 900, 
        300, 500, 500)), "-",
    group_id=c(rep("A", 4), rep("B", 5), rep("C", 2)))
features

# GRanges object with 11 ranges and 1 metadata column:
#       seqnames       ranges strand   |    group_id
#          <Rle>    <IRanges>  <Rle>   | <character>
#   [1]    chr2L [1000, 1499]      -   |           A
#   [2]    chr2L [3000, 3499]      -   |           A
#   [3]    chr2L [4000, 4499]      -   |           A
#   [4]    chr2L [7000, 7599]      -   |           A
#   [5]    chr2R [2000, 2899]      -   |           B
#   ...      ...          ...    ... ...         ...
#   [7]    chr2R [3600, 3899]      -   |           B
#   [8]    chr2R [4000, 4899]      -   |           B
#   [9]    chr2R [7500, 7799]      -   |           B
#  [10]    chr3L [5000, 5499]      -   |           C
#  [11]    chr3L [5400, 5899]      -   |           C
#  -------
#  seqinfo: 3 sequences from an unspecified genome; no seqlengths
olap
# class: SummarizedExperiment 
# dim: 11 2 
# exptData(0):
# assays(1): counts
# rownames: NULL
# rowData metadata column names(1): group_id
# colnames(2): sm_treated1.bam sm_untreated1.bam
# colData names(0):

assays(olap)$counts
#       sm_treated1.bam sm_untreated1.bam
#  [1,]               0                 0
#  [2,]               0                 0
#  [3,]               0                 0
#  [4,]               0                 0
#  [5,]               5                 1
#  [6,]               5                 0
#  [7,]               2                 0
#  [8,]             376               104
#  [9,]               0                 0
# [10,]               0                 0
# [11,]               0                 0

Pasilla data. Note that the bam files are not clear where to find them. According to the message, we can download SAM files first and then convert them to BAM files by samtools (Not verify yet).

samtools view -h -o outputFile.bam inputFile.sam

A modified R code that works is

###################################################
### code chunk number 11: gff (eval = FALSE)
###################################################
library(rtracklayer)
fl <- paste0("ftp://ftp.ensembl.org/pub/release-62/",
             "gtf/drosophila_melanogaster/",
             "Drosophila_melanogaster.BDGP5.25.62.gtf.gz")
gffFile <- file.path(tempdir(), basename(fl))
download.file(fl, gffFile)
gff0 <- import(gffFile, asRangedData=FALSE)

###################################################
### code chunk number 12: gff_parse (eval = FALSE)
###################################################
idx <- mcols(gff0)$source == "protein_coding" & 
           mcols(gff0)$type == "exon" & 
           seqnames(gff0) == "4"
gff <- gff0[idx]
## adjust seqnames to match Bam files
seqlevels(gff) <- paste("chr", seqlevels(gff), sep="")
chr4genes <- split(gff, mcols(gff)$gene_id)

###################################################
### code chunk number 12: gff_parse (eval = FALSE)
###################################################
library(GenomicAlignments)

# fls <- c("untreated1_chr4.bam", "untreated3_chr4.bam")
fls <- list.files(system.file("extdata", package="pasillaBamSubset"),
     recursive=TRUE, pattern="*bam$", full=TRUE)
path <- system.file("extdata", package="pasillaBamSubset")
bamlst <- BamFileList(fls)
genehits <- summarizeOverlaps(chr4genes, bamlst, mode="Union") # SummarizedExperiment object
assays(genehits)$counts

###################################################
### code chunk number 15: pasilla_exoncountset (eval = FALSE)
###################################################
library(DESeq)

expdata = MIAME(
              name="pasilla knockdown",
              lab="Genetics and Developmental Biology, University of 
                  Connecticut Health Center",
              contact="Dr. Brenton Graveley",
              title="modENCODE Drosophila pasilla RNA Binding Protein RNAi 
                  knockdown RNA-Seq Studies",
              pubMedIds="20921232",
              url="http://www.ncbi.nlm.nih.gov/projects/geo/query/acc.cgi?acc=GSE18508",
              abstract="RNA-seq of 3 biological replicates of from the Drosophila
                  melanogaster S2-DRSC cells that have been RNAi depleted of mRNAs 
                  encoding pasilla, a mRNA binding protein and 4 biological replicates 
                  of the the untreated cell line.")

design <- data.frame(
              condition=c("untreated", "untreated"),
              replicate=c(1,1),
              type=rep("single-read", 2), stringsAsFactors=TRUE)
library(DESeq)
geneCDS <- newCountDataSet(
                  countData=assay(genehits),
                  conditions=design)

experimentData(geneCDS) <- expdata
sampleNames(geneCDS) = colnames(genehits)

###################################################
### code chunk number 16: pasilla_genes (eval = FALSE)
###################################################
chr4tx <- split(gff, mcols(gff)$transcript_id)
txhits <- summarizeOverlaps(chr4tx, bamlst)
txCDS <- newCountDataSet(assay(txhits), design) 
experimentData(txCDS) <- expdata

We can also check out ?summarizeOverlaps to find some fake examples.

tidybulk

Bisque

Bisque: An R toolkit for accurate and efficient estimation of cell composition ('decomposition') from bulk expression data with single-cell information.

chromoMap

Inference

tximport

  • http://bioconductor.org/packages/release/bioc/html/tximport.html
    $ head -5 quant.sf 
    Name	Length	EffectiveLength	TPM	NumReads
    ENST00000456328.2	1657	1410.79	0.083908	2.46885
    ENST00000450305.2	632	410.165	0	0
    ENST00000488147.1	1351	1035.94	10.4174	225.073
    ENST00000619216.1	68	24	0	0
    ENST00000473358.1	712	453.766	0	0
    
  • Another real data from PDMR -> PDX. Select Genomic Analysis -> RNASeq and TPM(genes) column. Consider Patient ID=114348, Specimen ID=004-R, Sample ID=ATHY22, CTEP SDC Code=10038045,
    $ head -2 114348_004-R_ATHY22_v2.0.1.4.0_RNASeq.RSEM.genes.results 
    gene_id	transcript_id.s. length	effective_length  expected_count  TPM	  FPKM
    5S_rRNA	uc021ofx.1	 105.04	2.23	          2039.99	  49629.87 35353.97
    
    $ R
    x = read.delim("114348_004-R_ATHY22_v2.0.1.4.0_RNASeq.RSEM.genes.results")
    dim(x)
    # [1] 28109     7
    names(x)
    # [1] "gene_id"          "transcript_id.s." "length"           "effective_length"
    # [5] "expected_count"   "TPM"              "FPKM"            
    x[1:3, -2]
    #     gene_id length effective_length expected_count      TPM     FPKM
    # 1   5S_rRNA 105.04             2.23        2039.99 49629.87 35353.97
    # 2 5_8S_rRNA 161.00            21.19           0.00     0.00     0.00
    # 3    6M1-18 473.00           302.74           0.00     0.00     0.00
    
    y <- read.delim("114348_004-R_ATHY22_v2.0.1.4.0_RNASeq.RSEM.isoforms.results")
    dim(y)
    # [1] 78375     8
    names(y)
    # [1] "transcript_id"    "gene_id"          "length"           "effective_length"
    # [5] "expected_count"   "TPM"              "FPKM"             "IsoPct" 
    y[1:3, -1]
    #   gene_id length effective_length expected_count TPM FPKM IsoPct
    # 1 5S_rRNA    110             3.06              0   0    0      0
    # 2 5S_rRNA    133             9.08              0   0    0      0
    # 3 5S_rRNA     92             0.00              0   0    0      0
    

File:RSEM PDX.png

DESeq2 or edgeR

Shrinkage estimators

  • The package uses a negative binomial statistical model to fit the count data, and can account for differences in sequencing depth across samples.
    • Shrinkage is a technique used to regularize the estimates of the parameters of the negative binomial model.
    • The idea behind shrinkage is to pull the estimated values of the parameters towards a prior distribution, which can help to reduce the variability of the estimates and improve the stability of the results.
    • The specific shrinkage method used in DESeq2 is called the "shrinkage prior for dispersion" method. This method involves adding a prior distribution on the dispersion parameter of the negative binomial model, which is used to control the degree of overdispersion in the data.
    • This prior distribution is designed to shrink the estimated values of the dispersion parameter towards a common value across all the genes in the dataset, which can help to reduce the variance of the estimated log-fold changes.
  • More details:
    • The negative binomial model is used to model the count data, y, as a function of the mean, [math]\displaystyle{ \mu }[/math], and the dispersion, [math]\displaystyle{ \alpha }[/math]. The probability mass function of the negative binomial is given by:
    [math]\displaystyle{ \begin{align} P(y | \mu, \alpha) = (y + \alpha - 1)! / (y! * (\alpha - 1)!) * (\mu / (\mu + \alpha))^y * (\alpha / (\mu + \alpha))^\alpha \end{align} }[/math]
    • The likelihood of the data is given by:
    [math]\displaystyle{ \begin{align} L(\mu, \alpha | y) = \prod_i [ P(y_i | \mu_i, \alpha) ] \end{align} }[/math]
    • The log-likelihood is :
    [math]\displaystyle{ \begin{align} logL(\mu, \alpha | y) = \sum_i [ \log(P(y_i | \mu_i, \alpha)) ] \end{align} }[/math]
    In this model, [math]\displaystyle{ \mu }[/math] is the mean of the negative binomial for each gene and it is modeled as a linear function of the design matrix.
    [math]\displaystyle{ \begin{align} \mu_i = exp(X_i \beta) \end{align} }[/math]
    [math]\displaystyle{ \alpha }[/math] is the dispersion parameter and it's the same for all the genes, following the common practice in RNA-seq analysis
    • The shrinkage prior is added on [math]\displaystyle{ \alpha }[/math], it assumes that [math]\displaystyle{ \alpha }[/math] is following a hyper-prior distribution like Gamma distribution
    [math]\displaystyle{ \begin{align} \alpha \sim \Gamma(a_0, b_0) \end{align} }[/math]
    This prior allows the shrinkage of [math]\displaystyle{ \alpha }[/math] estimates from the data towards a common value across all the genes, which can help to reduce the variance of the estimated log-fold changes.
    • The goal is to find the values of mu and alpha that maximize the log-likelihood, this is done by using maximum likelihood estimation (MLE) or Bayesian approach where the prior are considered and integrated in the calculation and the result is the posterior probability.
  • Dispersion parameter.
    • In the context of the negative binomial model used in DESeq2, the dispersion parameter, alpha, is a measure of the degree of overdispersion in the data. In other words, it represents the variability of the data around the mean. A value of alpha greater than 1 indicates that the data is more dispersed (more variable) than would be expected if the data were following a Poisson distribution, which is a common distribution used to model count data. The Poisson distribution has a single parameter, the mean, which represents both the location and the scale of the distribution. In contrast, the negative binomial distribution has two parameters, the mean and the dispersion, which allows for more flexibility in fitting the data.
    • The shrinkage method in DESeq2 involves shrinking the estimated values of the dispersion parameter towards a common value across all the genes in the dataset, which can help to reduce the variance of the estimated log-fold changes.
  • What is the formula of the fold change estimator given by DESeq2?
    • The fold change estimator given by the DESeq2 package is calculated as the ratio of the estimated mean expression levels in two conditions, with the log2 of this ratio being the log2 fold change. The mean expression levels are calculated using a negative binomial model, which accounts for both the mean and the overdispersion of the data.
    • The estimated mean expression level for a gene i in condition j is given by:
    [math]\displaystyle{ \begin{align} \log(\mu_{i,j}) = \beta_j + X_i \gamma \end{align} }[/math]
    where [math]\displaystyle{ \beta_j }[/math] is the overall mean for condition [math]\displaystyle{ j }[/math], [math]\displaystyle{ X_i }[/math] is the design matrix for gene [math]\displaystyle{ i }[/math] and [math]\displaystyle{ \gamma_i }[/math] is the gene-specific effect.
    • The log2 fold change is calculated as:
    [math]\displaystyle{ \begin{align} \log2(\mu_{i,j} / \mu_{i,k}) \end{align} }[/math]
    where j and k are the two conditions being compared.
    • So, you can see that the fold change estimator depends on the design matrix [math]\displaystyle{ X }[/math] and the parameters of the model, [math]\displaystyle{ \beta }[/math] and [math]\displaystyle{ \gamma }[/math]. The DESeq2 implementation also includes an estimation of the variance-covariance matrix of the parameters to compute the standard deviation (uncertainty) of these parameters, and therefore the standard deviation on the fold-change estimator. This can help to estimate the significance of the fold change between conditions.
    • Hypothesis testing H0: log(FC)=0 using Wald test
  • What is the variance of the estimated log-fold changes before and after applying DESeq2 method?
    • In RNA-seq data analysis, the log-fold change is a measure of the relative difference in expression between two conditions. The log-fold change is calculated as the log2 of the ratio of the mean expression in one condition to the mean expression in another condition.
    • Without using any methods like DESeq2, the variance of the estimated log-fold changes can be high, particularly for genes with low expression levels, which can lead to unreliable results. This high variance is due to the over-dispersion present in RNA-seq data, which results in a large variability in the estimated expression levels even for genes with similar means.
    • When using the DESeq2 package, the shrinkage method is applied on dispersion parameter alpha, which helps to reduce the variance of the estimated log-fold changes. By applying a prior on alpha and by shrinking the estimates of alpha towards a common value across all the genes, the method reduces the variability of the estimates. This results in more stable and reliable estimates of the log-fold changes, which can improve the accuracy and robustness of the results of the differential expression analysis.
    • Additionally, the DESeq2 package also accounts for differences in sequencing depth across samples, which can also help to reduce the variability of the estimated log-fold changes.
  • how DESeq2 package accounts for differences in sequencing depth across samples
    • The DESeq2 package accounts for differences in sequencing depth across samples by using the raw count data to estimate the normalized expression levels for each gene in each sample. This normalization process is necessary because sequencing depth can vary widely between samples, leading to differences in the overall number of reads and the apparent expression levels of the genes.
    • The package uses a method called regularized-logarithm (rlog) transformation to normalize the data, which is a variance stabilization method that is based on the logarithm of the counts, but also adjusts for the total library size and the mean expression level.
    • The method starts by computing a weighted mean of the counts across all samples, which is used as a reference. Next, for each sample, the counts are divided by the library size and then multiplied by the weighted mean of the counts. This scaling step corrects for differences in sequencing depth by making the library sizes comparable between samples.
    • Then, the regularized logarithm (rlog) transformation is applied to the scaled counts, which is given by :
    [math]\displaystyle{ \begin{align} vst = \log(counts/sizeFactor + c) \end{align} }[/math]
    where c is a small positive constant added to the counts to stabilize the variance, size_factor is the ratio of library size for each sample over the weighted mean of the library size.
    • The rlog transformation can stabilize the variance of the data and make the mean expression levels more comparable between samples. This transformed data can then be used for downstream analysis like calculating the fold changes.
    • In addition to rlog transformation the DESeq2 package uses a negative binomial distribution to model the count data, this distribution helps to account for over-dispersion in the data, and shrinkage method on the dispersion parameter is applied as well to improve the stability of results. All of these techniques work together to help correct for sequencing depth differences across samples, which can improve the accuracy of the estimated fold changes and provide more robust results in differential gene expression analysis.
  • type='apeglm' shrinkage only for use with 'coef'

Time course experiment

  • Time course trend analysis from the edgeR's vignette. glmQLFTest()
    • Finds genes that respond to the treatment at either 1 hour or 2 hours versus the 0 hour baseline. This is analogous to an ANOVA F-test for a normal linear model.
    • Assuming gene expression changes smoothly over time, we can use a polynomial or a cubic spline curve with a certain number of degrees of freedom to model gene expression along time.
    • We are looking for genes that change expression level over time. We test for a trend by conducting F-tests for each gene. The topTags function lists the top set of genes with most significant time effects.
    • The total number of genes with significant (5% FDR) changes at different time points can be examined with decideTests.
  • RNA-seq data collected at different time points. Identify differentially expressed genes associated with seasonal changes

DESeq2 experimental design and interpretation

DESeq2 experimental design and interpretation

Controlling for batch differences

The variable we are interested in ("condition") is placed after the batch variable.

dds <- DESeqDataSetFromMatrix(countData = cts,
                              colData = coldata,
                              design= ~ batch + condition)
dds <- DESeq(dds)

OR

dds <- DESeq(dds, test="LRT", reduced=~batch)
res <- results(dds)

DESeq2 diagnostic plot, MA plot

  • RNA-Seq differential expression work flow using DESeq2. MA plot, dispersion plot, histogram of p-values, rlog transoformation.
  • RNA-seq Analysis in R Annotation and Visualisation of Differential Expression Results. MA plot, Volcano plot, venn diagram, heatmap (ComplexHeatmap).
  • R packages:
  • MA plot
    • MA plots help detect systematic biases, especially mean-dependent variability, which is common in RNA-seq.
    • Assess Normalization:
      • Before normalization, MA plots often show a curved or spread pattern.
      • After proper normalization (e.g., voom, DESeq2::rlog, or TMM), the cloud of points should be centered at M ≈ 0 across all A levels.
    • M can be obtained from limma::eBayes(fit)$coefficient[, i] or limma::topTable(fit)$logFC
    • M(=log2FC) was used in both MA plots (Y-axis) and volcano plots (X-axis).
    • A gene with log2FC = 1 might be significant if it’s highly expressed, but not significant if it’s lowly expressed.

vst over rlog transformation

Expected counts
     | round()
     v                              /-- vst transformation  ---\
Raw counts --> normalized counts  --                            -- Other analyses such as PCA, Hclust (sample distances).
                                    \-- rlog transformation ---/

Simulate negative binomial distribution data

  • rnegbin() in sim.counts() from the ssizeRNA package
    rnegbin(10000 * 10, lambda, 1 / disp) 
    # 10000 genes, 20 samples
    # lambda: mean counts from control group, a matrix. 
    # disp: dispersion parameter, a matrix.
    

Reducing false positives in differential analyses of large RNA sequencing data sets

edgeR vs DESeq2 vs limma-voom

  • edgeR. ?calcNormFactors
    library(edgeR)
    
    # create DGEList object from count data
    counts <- matrix(c(20,30,25,50,45,55,15,20,10,5,10,8,100,120,110,80,90,95), nrow=3, ncol=6, byrow=TRUE)
    rownames(counts) <- c("G1", "G2", "G3")
    colnames(counts) <- c("A1", "A2", "A3", "B1", "B2", "B3")
    counts
    #     A1  A2  A3 B1 B2 B3
    # G1  20  30  25 50 45 55
    # G2  15  20  10  5 10  8
    # G3 100 120 110 80 90 95
    d <- DGEList(counts)
    
    # perform normalization and differential expression analysis
    d <- calcNormFactors(d)
    design <- model.matrix(~0+factor(c(rep("A",3), rep("B",3))))
    d <- estimateDisp(d, design)
    fit <- glmQLFit(d, design)
    res <- glmQLFTest(fit, contrast=c(-1, 1))
    
    # summarize the results and identify significant genes
    summary(res)
    res2 <- topTags(res); res2
    # Coefficient:  -1*factor(c(rep("A", 3), rep("B", 3)))A 1*factor(c(rep("A", 3), rep("B", 3)))B 
    #         logFC   logCPM          F       PValue          FDR
    # G1  1.1683093 17.98614 146.579840 4.380158e-08 1.314048e-07
    # G2 -0.7865080 16.41917   3.056504 1.059256e-01 1.588884e-01
    # G3 -0.1437956 19.34279  40.852893 2.256279e-01 2.256279e-01
    de_genes <- rownames(res2)[which(res2$FDR < 0.05 & abs(res2$log2FoldChange) > 1)]
  • DESeq2. The count data above will result in an error. The error can occur when there is very little variability in the count data, which can happen if the biological samples are very homogeneous or if the sequencing depth is very low. In such cases, it may be difficult to reliably identify differentially expressed genes using DESeq2.
    library(DESeq2)
    
    col_data <- data.frame(condition = factor(rep(c("treated", "untreated"), c(3, 3))))
    
    # create a DESeq2 dataset object
    dds <- DESeqDataSetFromMatrix(countData = counts, colData = col_data, design = ~ condition)
    
    # differential expression analysis
    dds <- DESeq(dds)
    # estimating size factors
    # estimating dispersions
    # gene-wise dispersion estimates
    # mean-dispersion relationship
    # Error in estimateDispersionsFit(object, fitType = fitType, quiet = quiet) : 
    #   all gene-wise dispersion estimates are within 2 orders of magnitude
    #   from the minimum value, and so the standard curve fitting techniques will not work.
    #   One can instead use the gene-wise estimates as final estimates:
    #   dds <- estimateDispersionsGeneEst(dds)
    #   dispersions(dds) <- mcols(dds)$dispGeneEst
    #   ...then continue with testing using nbinomWaldTest or nbinomLRT

    Try another data.

    count_data <- matrix(c(100, 500, 200, 1000, 300,
                           200, 400, 150, 500, 300,
                           300, 300, 100, 1500, 300,
                           400, 200, 50, 2000, 300), nrow = 5, byrow = TRUE)
    
    colnames(count_data) <- paste0("sample", 1:4)
    rownames(count_data) <- paste0("gene", 1:5)
    col_data <- data.frame(condition = factor(rep(c("treated", "untreated"), c(2, 2))))
    
    # create a DESeq2 dataset object
    dds <- DESeqDataSetFromMatrix(countData = count_data, colData = col_data, design = ~ condition)
    # estimating size factors
    # estimating dispersions
    # gene-wise dispersion estimates
    # mean-dispersion relationship
    # -- note: fitType='parametric', but the dispersion trend was not well captured by the
    #    function: y = a/x + b, and a local regression fit was automatically substituted.
    #    specify fitType='local' or 'mean' to avoid this message next time.
    # final dispersion estimates
    # fitting model and testing
    # Warning message:
    # In lfproc(x, y, weights = weights, cens = cens, base = base, geth = geth,  :
    #   Estimated rdf < 1.0; not estimating variance
    
    # differential expression analysis
    dds <- DESeq(dds)
    
    # extract results
    res <- results(dds)
    res
    # log2 fold change (MLE): condition untreated vs treated 
    # Wald test p-value: condition untreated vs treated 
    # DataFrame with 5 rows and 6 columns
    #        baseMean log2FoldChange     lfcSE      stat    pvalue      padj
    #       <numeric>      <numeric> <numeric> <numeric> <numeric> <numeric>
    # gene1   465.558       0.707313  1.243608  0.568758 0.5695201  0.711900
    # gene2   309.591      -0.119330  0.885551 -0.134752 0.8928081  0.892808
    # gene3   413.959      -0.742921  0.513376 -1.447130 0.1478604  0.369651
    # gene4   638.860      -1.372724  1.428977 -0.960634 0.3367360  0.561227
    # gene5   721.470       2.928705  1.536174  1.906493 0.0565863  0.282931
    
    # extract DE genes with adjusted p-value < 0.05 and |log2 fold change| > 1
    DESeq2_DE_genes <- subset(res, padj < 0.05 & abs(log2FoldChange) > 1)
    
    # print the number of DE genes identified by DESeq2
    cat("DESeq2 identified", nrow(DESeq2_DE_genes), "DE genes.\n")
  • limma-voom. voom is a function in the limma package that modifies RNA-Seq data for use with limma. Differential Expression with Limma-Voom. ?voom.
    • Converts raw counts to log2-counts per million (log2-CPM) values
    • The voom() function requires a design matrix for several important reasons
      • Estimating mean-variance relationship: voom uses the design matrix to fit a linear model and calculate residuals, which are then used to estimate the mean-variance trend in the data
      • Calculating weights: The fitted values from the linear model are used to interpolate variances for each observation based on the mean-variance trend. These variances are then used to compute precision weights for each observation
      • Adjusting for heteroscedasticity: The weights calculated using the design matrix help adjust for the heteroscedasticity typically present in RNA-seq count data
      • Accounting for experimental design: The design matrix allows voom to consider the experimental structure, including factors like treatment groups or batch effects, when estimating the mean-variance relationship
      • We get smoothed, stabilized variances, rather than heteroscedastic (noisy at low counts) variance of genes.
    library(limma)
    library(edgeR)
    
    # Create a design matrix with the sample groups
    design_matrix <- model.matrix(~ condition, data = col_data)
    
    # Transform RNA-Seq Data Ready for Linear Modelling; see the limma vignette
    
    # Method 1: voom transformation is applied to the scale normalized and filtered DGEList object
    # The filterByExpr() function from the edgeR package is an automated method for 
    # filtering low-count genes in RNA-seq data analysis.
    dge <- DGEList(counts)
    keep <- filterByExpr(dge, design)
    dge <- dge[keep,,keep.lib.sizes=FALSE]
    dge <- calcNormFactors(dge)
    v <- voom(dge, design_matrix, plot=TRUE)
    
    # Method 2: convert the read counts to log2-cpm
    # filter out low-expressed genes
    if (FALSE) {
      keep <- rowSums(counts) >= 10
      counts <- counts[keep,]
    }
    # give a matrix of counts directly to voom without TMM normalization
    v <- voom(count, design_matrix)
    
    # linear model fitting
    fit <- lmFit(v, design_matrix)
    
    # Calculate the empirical Bayes statistics
    fit <- eBayes(fit)
    
    top.table <- topTable(fit, sort.by = "P", n = Inf)
    top.table
    #            logFC  AveExpr          t    P.Value adj.P.Val         B
    # gene3 -2.3242262 15.67787 -1.8229203 0.08330054 0.3153894 -4.249298
    # gene5  2.0865122 16.34012  1.5960616 0.12615577 0.3153894 -4.376405
    # gene1  0.5610761 16.69722  0.5079444 0.61704872 0.7551329 -4.834183
    # gene2  0.2477959 18.69843  0.3829295 0.70581164 0.7551329 -5.150958
    # gene4  0.2869870 17.11809  0.3161922 0.75513288 0.7551329 -4.963932
    
    # Perform hypothesis testing to identify DE genes
    results <- decideTests(fit)
    
    summary(results)
    #        (Intercept) conditionuntreated
    # Down             0                  0
    # NotSig           0                  5
    # Up               5                  0
    
    # Extract the DE genes
    de_genes <- rownames(count_data)[which(results$all != 0)]

DESeq2 vs edgeR

D vs E?

  • One major difference is in the method used to estimate the dispersion parameter. DESeq2 uses a local regression method, whereas edgeR uses a Cox-Reid profile-adjusted likelihood method. The local regression method estimates the dispersion parameter for each gene independently, whereas the profile-adjusted likelihood method estimates a common dispersion parameter for all genes, with gene-specific scaling factors that depend on the mean expression levels.
  • Another difference is in the approach to normalization. DESeq2 uses a variance-stabilizing transformation to account for differences in library size and composition, whereas edgeR uses a trimmed mean of M-values (TMM) normalization method, which adjusts for library size differences by scaling the counts of each sample to a common effective library size.
  • DESeq2 also uses a different statistical model for differential expression analysis. DESeq2 models the count data as a negative binomial distribution, but includes additional terms to account for batch effects and other sources of variation. It uses a shrinkage estimator to improve the estimation of fold changes and reduce false positives. EdgeR, on the other hand, uses a similar negative binomial model but applies an empirical Bayes method to estimate gene-specific dispersions and to borrow information across genes to improve the power of detection and reduce false positives.

When should I choose DESeq2 and when should I choose edgeR?

  • The choice between DESeq2 and edgeR for differential gene expression analysis depends on several factors, including the experimental design, sample size, and the nature of the biological question being investigated. Here are some general guidelines to help you choose between these two algorithms:
  • Choose DESeq2 when:
    • The experimental design includes multiple batches or covariates that may affect the gene expression levels
    • The sample size is small, typically fewer than 12 samples per group
    • The gene expression levels are highly variable across replicates, and the goal is to identify differentially expressed genes with a low false discovery rate (FDR)
    • The focus is on the fold change rather than the statistical significance of differential expression
  • Choose edgeR when:
    • The experimental design includes several factors, such as treatment, time, and biological replicate, and the goal is to identify the main effects and interaction effects of these factors on gene expression
    • The sample size is moderate to large, typically more than 12 samples per group
    • The gene expression levels are less variable across replicates, and the goal is to achieve high statistical power to detect differentially expressed genes
    • The focus is on both the fold change and the statistical significance of differential expression, and the researcher is interested in performing downstream analyses such as gene set enrichment analysis or pathway analysis.

Huge different results between edgeR and DESeq2.

  • Different statistical models: DESeq2 and edgeR use different statistical approaches to model gene expression data. DESeq2 employs a Wald test by default, while edgeR uses a quasi-likelihood F-test. These distinct methods can lead to divergent p-value calculations. See Hugely different results between edgeR and DESeq2.
  • Outlier handling: DESeq2 automatically performs outlier removal by default, whereas edgeR does not. This difference in outlier treatment could significantly affect p-values for genes with extreme values. See Hugely different results between edgeR and DESeq2.
  • Dispersion estimation: The two methods use different approaches for estimating dispersion, which is crucial for modeling biological variability. DESeq2's approach might be more sensitive to certain patterns of variability for this particular gene. See DESeq2 or edgeR.
  • Normalization differences: Although both methods use similar normalization techniques, subtle differences in implementation could lead to discrepancies in results for some genes. See Deseq2 / EdgeR challenges.
  • Low count handling: DESeq2 and edgeR handle genes with low counts differently. If the gene in question has low expression, this could contribute to the observed difference in p-values. See DESeq2 or edgeR.
Comparison of Methods: calcNormFactors vs DESeq2::counts(normalize=TRUE)
Feature calcNormFactors (edgeR) DESeq2::counts(normalize=TRUE)
Normalization Method TMM/Trimmed Mean of M-values Median of Ratios (specific implementation of Relative Log Expression/RLE) as factor size (scaling factor)
Adjusts for Composition Bias? Yes Yes
Output Scaling factors for normalization (used indirectly) Normalized counts (explicit output)
Main Usage Pipeline integration (CPM, voom) Direct analysis or visualization
Implicit Normalization Yes Yes
DE method 1. Estimates gene-wise dispersions using empirical Bayes methods,
2. Fits a negative binomial model to the count data,
3. Performs hypothesis testing using either: Exact test exactTest() or LRT glmLRT().
1. Estimates gene-wise dispersions and shrinks these estimates,
2. Fits a negative binomial model to the count data.
3. Performs hypothesis testing using the Wald test DESeq()

DESeq2 in Python

PyDESeq2, nice work

Generalized Linear Models and Plots with edgeR

Generalized Linear Models and Plots with edgeR – Advanced Differential Expression Analysis

EBSeq

An R package for gene and isoform differential expression analysis of RNA-seq data

http://www.rna-seqblog.com/analysis-of-ebv-transcription-using-high-throughput-rna-sequencing/

prebs

Probe region expression estimation for RNA-seq data for improved microarray comparability

DEXSeq

Inference of differential exon usage in RNA-Seq

rSeqNP

A non-parametric approach for detecting differential expression and splicing from RNA-Seq data

voomDDA: discovery of diagnostic biomarkers and classification of RNA-seq data

http://www.biosoft.hacettepe.edu.tr/voomDDA/

Pathway analysis

About the KEGG pathways

  • MSigDB database or msigdbr package - seems to be old. It only has 186 KEGG pathways for human.
  • msigdb from Bioconductor
  • KEGGREST package directly pull the data from kegg.jp. I can get 337 KEGG pathways for human ('hsa')
    BiocManager::install("KEGGREST")
    library(KEGGREST)
    res <- keggList("pathway", "hsa") 
    length(res) # 337
    

GSOAP

GSOAP: a tool for visualization of gene set over-representation analysis

clusterProfiler

fgsea: Fast Gene Set Enrichment Analysis

GSEABenchmarkeR: Reproducible GSEA Benchmarking

Towards a gold standard for benchmarking gene set enrichment analysis

hypeR

GSEPD

GSEPD: a Bioconductor package for RNA-seq gene set enrichment and projection display

SeqGSEA

http://www.bioconductor.org/packages/release/bioc/html/SeqGSEA.html

BAGSE

BAGSE: a Bayesian hierarchical model approach for gene set enrichment analysis 2020

GeneSetCluster

GeneSetCluster: a tool for summarizing and integrating gene-set analysis results

Pipeline

SPEAQeasy

SPEAQeasy – a scalable pipeline for expression analysis and quantification for R/Bioconductor-powered RNA-seq analyses

Nextflow

GeneTEFlow

GeneTEFlow – A Nextflow-based pipeline for analysing gene and transposable elements expression from RNA-Seq data

pipeComp

pipeComp, a general framework for the evaluation of computational pipelines, reveals performant single-cell RNA-seq preprocessing tools

SARTools

http://www.rna-seqblog.com/sartools-a-deseq2-and-edger-based-r-pipeline-for-comprehensive-differential-analysis-of-rna-seq-data/

SEQprocess

SEQprocess: a modularized and customizable pipeline framework for NGS processing in R package

GEMmaker

GEMmaker, Paper

pasilla and pasillaBamSubset Data

pasilla - Data package with per-exon and per-gene read counts of RNA-seq samples of Pasilla knock-down by Brooks et al., Genome Research 2011.

pasillaBamSubset - Subset of BAM files untreated1.bam (single-end reads) and untreated3.bam (paired-end reads) from "Pasilla" experiment (Pasilla knock-down by Brooks et al., Genome Research 2011).

BitSeq

Transcript expression inference and differential expression analysis for RNA-seq data. The homepage of Antti Honkela.

ReportingTools

The ReportingTools software package enables users to easily display reports of analysis results generated from sources such as microarray and sequencing data.

Figures can be included in a cell in output table. See Using ReportingTools in an Analysis of Microarray Data.

It is suggested by e.g. EnrichmentBrowser.

sequences

More or less an educational package. It has 2 c and c++ source code. It is used in Advanced R programming and package development.

QuasR

Bioinformatics paper

CRAN/Bioconductor packages

ssizeRNA

RNASeqPower

RNASeqPower Sample size for RNAseq studies

RnaSeqSampleSize

Shiny app

rbamtools

Provides an interface to functions of the 'SAMtools' C-Library by Heng Li

refGenome

The packge contains functionality for import and managing of downloaded genome annotation Data from Ensembl genome browser (European Bioinformatics Institute) and from UCSC genome browser (University of California, Santa Cruz) and annotation routines for genomic positions and splice site positions.

WhopGenome

Provides very fast access to whole genome, population scale variation data from VCF files and sequence data from FASTA-formatted files. It also reads in alignments from FASTA, Phylip, MAF and other file formats. Provides easy-to-use interfaces to genome annotation from UCSC and Bioconductor and gene ontology data from AmiGO and is capable to read, modify and write PLINK .PED-format pedigree files.

TCGA2STAT

Simple TCGA Data Access for Integrated Statistical Analysis in R

TCGA2STAT depends on Bioconductor package CNTools which cannot be installed automatically.

source("https://bioconductor.org/biocLite.R")
biocLite("CNTools")

install.packages("TCGA2STAT")

The getTCGA() function allows to download various kind of data:

  • gene expression which includes mRNA-microarray gene expression data (data.type="mRNA_Array") & RNA-Seq gene expression data (data.type="RNASeq")
  • miRNA expression which includes miRNA-array data (data.type="miRNA_Array") & miRNA-Seq data (data.type="miRNASeq")
  • mutation data (data.type="Mutation")
  • methylation expression (data.type="Methylation")
  • copy number changes (data.type="CNA_SNP")

TCGAbiolinks

  • An example from Public Data Resources in Bioconductor workshop 2020. According to ?GDCquery, for the legacy data arguments project, data.category, platform and/or file.extension should be used.
    library(TCGAbiolinks)
    library(SummarizedExperiment)
    query <- GDCquery(project = "TCGA-ACC",
                               data.category = "Gene expression",
                               data.type = "Gene expression quantification",
                               platform = "Illumina HiSeq", 
                               file.type  = "normalized_results",
                               experimental.strategy = "RNA-Seq",
                               legacy = TRUE)
    
    gdcdir <- file.path("Waldron_PublicData", "GDCdata")
    GDCdownload(query, method = "api", files.per.chunk = 10,
                directory = gdcdir)  # 79 files
    ACCse <- GDCprepare(query, directory = gdcdir)
    ACCse
    class(ACCse)
    dim(assay(ACCse))  # 19947 x 79
    assay(ACCse)[1:3, 1:2] # symbol id
    length(unique(rownames(assay(ACCse))))   #  19672
    rowData(ACCse)[1:2, ]
    # DataFrame with 2 rows and 3 columns
    #          gene_id entrezgene ensembl_gene_id
    #      <character>  <integer>     <character>
    # A1BG        A1BG          1 ENSG00000121410
    # A2M          A2M          2 ENSG00000175899
    
  • HTSeq counts data example. DeMixT. Error when running GDC_prepare.
    query2 <- GDCquery(project = "TCGA-ACC",
                       data.category = "Transcriptome Profiling",
                       data.type = "Gene Expression Quantification",
                       workflow.type="HTSeq - Counts") # or "STAR - Counts"
    gdcdir2 <- file.path("Waldron_PublicData", "GDCdata2")
    GDCdownload(query2, method = "api", files.per.chunk = 10,
                directory = gdcdir2)  # 79 files
    ACCse2 <- GDCprepare(query2, directory = gdcdir2)
    ACCse2
    dim(assay(ACCse2))  # 56457 x 79
    assay(ACCse2)[1:3, 1:2]  # ensembl id
    rowData(ACCse2)[1:2, ]
    DataFrame with 2 rows and 3 columns
                    ensembl_gene_id external_gene_name original_ensembl_gene_id
                        <character>        <character>              <character>
    ENSG00000000003 ENSG00000000003             TSPAN6       ENSG00000000003.13
    ENSG00000000005 ENSG00000000005               TNMD        ENSG00000000005.5
    
  • Clinical data
    acc_clin <- GDCquery_clinic(project = "TCGA-ACC", type = "Clinical")
    dim(acc_clin)
    # [1] 92 71
    
  • TCGAanalyze_DEA(). Differentially Expression Analysis (DEA) Using edgeR Package.
    dataNorm <- TCGAbiolinks::TCGAanalyze_Normalization(dataBRCA, geneInfo)
    dataFilt <- TCGAanalyze_Filtering(tabDF = dataBRCA, method = "quantile", qnt.cut =  0.25)
    samplesNT <- TCGAquery_SampleTypes(colnames(dataFilt), typesample = c("NT"))
    samplesTP <- TCGAquery_SampleTypes(colnames(dataFilt), typesample = c("TP"))
    dataDEGs <- TCGAanalyze_DEA(dataFilt[,samplesNT],
                          dataFilt[,samplesTP],"Normal", "Tumor")
    # 2nd example
    dataDEGs <- TCGAanalyze_DEA(mat1 = dataFiltLGG, mat2 = dataFiltGBM,
                               Cond1type = "LGG", Cond2type = "GBM",
                               fdr.cut = 0.01,  logFC.cut = 1,
                               method = "glmLRT")
    
  • Enrichment analysis
    ansEA <– TCGAanalyze_EAcomplete(TFname="DEA genes LGG Vs GBM", 
                                    RegulonList = rownames(dataDEGs))
    
    TCGAvisualize_EAbarplot(tf = rownames(ansEA$ResBP),
                            GOBPTab = ansEA$ResBP, GOCCTab = ansEA$ResCC,
                            GOMFTab = ansEA$ResMF, PathTab = ansEA$ResPat,
                            nRGTab = rownames(dataDEGs),
                            nBar = 20)
    
  • mRNA Analysis Pipeline from GDC documentation.
  • RangedSummarizedExperiment class
    • assay(()
    • colData()
    • rowData()
    • assayNames()
    • metadata()
    • > dim(colData(ACCse))
      [1] 79 72
      > dim(rowData(ACCse))
      [1] 19947     3
      > dim(assay(ACCse))
      [1] 19947    79
      > assayNames(ACCse)
      [1] "normalized_count"
      > assayNames(ACCse2)
      [1] "HTSeq - Counts"
      > metadata(ACCse)
      $data_release
      [1] "Data Release 25.0 - July 22, 2020"
      
  • TCGAbiolinks to DESEq2. My verified version (R 4.3.2 & Bioc ‘3.17’) available on Github.

curatedTCGAData

  • Public data resources and Bioconductor from Bioc2020
    library(curatedTCGAData)
    library(MultiAssayExperiment)
    curatedTCGAData(diseaseCode = "*", assays = "*")
    curatedTCGAData(diseaseCode = "ACC")
    
    ACCmae <- curatedTCGAData("ACC", c("RPPAArray", "RNASeq2GeneNorm"), 
                              dry.run=FALSE)
    ACCmae
    dim(colData(ACCmae)) # 79 (samples) x 822 (features)
    
    head(metadata(colData(ACCmae))[["subtypes"]])
    
  • Caveats for working with TCGA data
    • Not all TCGA samples are cancer, there are a mix of samples in each of the 33 cancer types.
    • Use sampleTables on the MultiAssayExperiment object along with data(sampleTypes, package = "TCGAutils") to see what samples are present in the data.
    • There may be tumors that were used to create multiple contributions leading to technical replicates. These should be resolved using the appropriate helper functions such as mergeReplicates.
    • Primary tumors should be selected using TCGAutils::TCGAsampleSelect and used as input to the subsetting mechanisms.

caOmicsV

http://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-0989-6 Data from TCGA ws used

Visualize multi-dimentional cancer genomics data including of patient information, gene expressions, DNA methylations, DNA copy number variations, and SNP/mutations in matrix layout or network layout.

Map2NCBI

The GetGeneList() function is useful to download Genomic Features (including gene features/symbols) from NCBI (ftp://ftp.ncbi.nih.gov/genomes/MapView/).

> library(Map2NCBI)
> GeneList = GetGeneList("Homo sapiens", build="ANNOTATION_RELEASE.107", savefiles=TRUE, destfile=path.expand("~/"))
  # choose [2], [n], and [1] to filter the build and feature information.
  # The destination folder will contain seq_gene.txt, seq_gene.md.gz and GeneList.txt files.
> str(GeneList)
'data.frame':	52157 obs. of  15 variables:
 $ tax_id       : chr  "9606" "9606" "9606" "9606" ...
 $ chromosome   : chr  "1" "1" "1" "1" ...
 $ chr_start    : num  11874 14362 17369 30366 34611 ...
 $ chr_stop     : num  14409 29370 17436 30503 36081 ...
 $ chr_orient   : chr  "+" "-" "-" "+" ...
 $ contig       : chr  "NT_077402.3" "NT_077402.3" "NT_077402.3" "NT_077402.3" ...
 $ ctg_start    : num  1874 4362 7369 20366 24611 ...
 $ ctg_stop     : num  4409 19370 7436 20503 26081 ...
 $ ctg_orient   : chr  "+" "-" "-" "+" ...
 $ feature_name : chr  "DDX11L1" "WASH7P" "MIR6859-1" "MIR1302-2" ...
 $ feature_id   : chr  "GeneID:100287102" "GeneID:653635" "GeneID:102466751" "GeneID:100302278" ...
 $ feature_type : chr  "GENE" "GENE" "GENE" "GENE" ...
 $ group_label  : chr  "GRCh38.p2-Primary" "GRCh38.p2-Primary" "GRCh38.p2-Primary" "GRCh38.p2-Primary" ...
 $ transcript   : chr  "Assembly" "Assembly" "Assembly" "Assembly" ...
 $ evidence_code: chr  "-" "-" "-" "-" ...
> GeneList$feature_name[grep("^NAP", GeneList$feature_name)]

TCseq: Time course sequencing data analysis

http://bioconductor.org/packages/devel/bioc/html/TCseq.html

UCSC Xena

RTCGA

https://www.bioconductor.org/packages/release/bioc/html/RTCGA.html

genefu

Computation of Gene Expression-Based Signatures in Breast Cancer

GEO

See the internal link at R-GEO.

GREIN: An interactive web platform for re-analyzing GEO RNA-seq data

GEO2RNAseq

GEO2RNAseq: An easy-to-use R pipeline for complete pre-processing of RNA-seq data

Network-based

Network-based integration of multi-omics data for clinical outcome prediction in neuroblastoma 2022

Proteomics

OlinkAnalyze

OlinkRPackage

Mass spectrometry (MS)-based proteomics

$ head -5 data_phosphoprotein_quantification.txt' | cut -f 1-5
ENTITY_STABLE_ID	GENE_SYMBOL	PHOSPHOSITE	01CO005	01CO006
AAAS_pS495	AAAS	pS495	NA	-0.365
AAAS_pS525	AAAS	pS525	NA	NA
AAAS_pS541	AAAS	pS541	-0.24	NA
AAED1_pS12	AAED1	pS12	-0.46	-0.424

# R
> summary(x[, 4], na.rm = T)
   Min. 1st Qu.  Median    Mean 3rd Qu.    Max.    NA's 
 -5.776  -1.095  -0.608  -0.690  -0.213   2.383   20378 
> summary(as.vector(as.matrix(x[, 4:5])), na.rm = T)
   Min. 1st Qu.  Median    Mean 3rd Qu.    Max.    NA's 
  -5.78   -0.81   -0.36   -0.43    0.00    3.13   36304 

Metabolomics Analysis

Enzyme

  • One gene, one enzyme. The one gene, one enzyme hypothesis is the idea that each gene encodes a single enzyme. Today, we know that this idea is generally (but not exactly) correct.
library(KEGGREST)

# Step 1: Retrieve KO entries associated with the enzyme
enzyme_id <- "ec:2.7.1.1"
ko_entries <- keggLink("ko", enzyme_id)

# Step 2: Retrieve genes associated with the KO entries
ko_ids <- sub("ko:", "", ko_entries)  # Extract KO IDs
gene_links <- lapply(ko_ids, function(ko) keggLink("genes", paste0("ko:", ko)))

# Combine results into a data frame
genes_df <- do.call(rbind, lapply(names(gene_links), function(ko) {
  data.frame(KO = ko, Gene = gene_links[[ko]], stringsAsFactors = FALSE)
}))

# View the first few rows of the genes data frame
head(genes_df)
  • Enzymes are the proteins that are encoded by genes.
  • Gene → Transcription → mRNA → Translation → Enzyme.
    • A gene is a segment of DNA that contains the instructions for making a protein. It's like a blueprint or a recipe for creating a specific protein.
    • Transcription: When a gene is "turned on" or expressed, the DNA sequence is transcribed into a complementary RNA molecule called messenger RNA (mRNA). This process is like copying the recipe from the DNA blueprint.
    • mRNA: The mRNA molecule carries the genetic information from the DNA to the ribosome, which is the site of protein synthesis.
    • Translation: The mRNA sequence is translated into a sequence of amino acids, which are the building blocks of proteins. This process is like following the recipe to assemble the ingredients into a final product.
    • Enzyme: The resulting protein, in this case, is an enzyme. Enzymes are biological molecules that catalyze specific chemical reactions, allowing them to speed up or facilitate various biological processes. An enzyme is a type of protein, but not all proteins are enzymes.

Protein-protein interaction/PPI

Drug-Drug Interactions

Understanding Drug-Drug Interactions Using R Shiny

Journals

Biometrical Journal

Biostatistics

Bioinformatics

Genome Analysis section

BMC Bioinformatics

BioRxiv

PLOS

MDPI

https://en.wikipedia.org/wiki/MDPI, All MDPI, Frontiers & Hindawi journals planned to be erased (level 0) from Finnish academic assessment by end of 2024.

Software

BRB-SeqTools

https://brb.nci.nih.gov/seqtools/

WebMeV

GeneSpring

RNA-Seq

CCBR Exome Pipeliner

https://ccbr.github.io/Pipeliner/

Tibanna

Tibanna helps you run your genomic pipelines on Amazon cloud (AWS). It is used by the 4DN DCIC (4D Nucleome Data Coordination and Integration Center) to process data. Tibanna supports CWL/WDL (w/ docker), Snakemake (w/ conda) and custom Docker/shell command.

MOFA: Multi-Omics Factor Analysis

WGCNA

Benchmarking

Essential guidelines for computational method benchmarking

Simulation

Simulate RNA-Seq

Maq

Used by TopHat: discovering splice junctions with RNA-Seq

BEERS/Grant G.R. 2011

http://bioinformatics.oxfordjournals.org/content/27/18/2518.long#sec-2. The simulation method is called BEERS and it was used in the STAR software paper.

For the command line options of <reads_simulator.pl> and more details about the config files that are needed/prepared by BEERS, see this gist.

This can generate paired end data but they are in one FASTA file.

$ sudo apt-get install cpanminus
$ sudo cpanm Math::Random
$ wget http://cbil.upenn.edu/BEERS/beers.tar
$
$ tar -xvf beers.tar      # two perl files <make_config_files_for_subset_of_gene_ids.pl> and <reads_simulator.pl>
$
$ cd ~/Downloads/
$ mkdir beers_output  
$ mkdir beers_simulator_refseq && cd "$_"
$ wget http://itmat.rum.s3.amazonaws.com/simulator_config_refseq.tar.gz
$ tar xzvf simulator_config_refseq.tar.gz
$ ls -lth 
total 1.4G
-rw-r--r-- 1 brb brb  44M Sep 16  2010 simulator_config_featurequantifications_refseq
-rw-r--r-- 1 brb brb 7.7M Sep 15  2010 simulator_config_geneinfo_refseq
-rw-r--r-- 1 brb brb 106M Sep 15  2010 simulator_config_geneseq_refseq
-rw-r--r-- 1 brb brb 1.3G Sep 15  2010 simulator_config_intronseq_refseq
$ cd ~/Downloads/
$ perl reads_simulator.pl 100 testbeers \
   -configstem refseq \
   -customcfgdir ~/Downloads/beers_simulator_refseq \
   -outdir ~/Downloads/beers_output

$ ls -lh beers_output
total 3.9M
-rw-r--r-- 1 brb brb 1.8K Mar 16 15:25 simulated_reads2genes_testbeers.txt
-rw-r--r-- 1 brb brb 1.2M Mar 16 15:25 simulated_reads_indels_testbeers.txt
-rw-r--r-- 1 brb brb 1.6K Mar 16 15:25 simulated_reads_junctions-crossed_testbeers.txt
-rw-r--r-- 1 brb brb 2.7M Mar 16 15:25 simulated_reads_substitutions_testbeers.txt
-rw-r--r-- 1 brb brb 6.3K Mar 16 15:25 simulated_reads_testbeers.bed
-rw-r--r-- 1 brb brb  31K Mar 16 15:25 simulated_reads_testbeers.cig
-rw-r--r-- 1 brb brb  22K Mar 16 15:25 simulated_reads_testbeers.fa
-rw-r--r-- 1 brb brb  584 Mar 16 15:25 simulated_reads_testbeers.log

$ wc -l simulated_reads2genes_testbeers.txt
102 simulated_reads2genes_testbeers.txt
$ head -4 simulated_reads2genes_testbeers.txt
seq.1	GENE.5600
seq.2	GENE.35506
seq.3	GENE.506
seq.4	GENE.34922
$ tail -4 simulated_reads2genes_testbeers.txt
seq.97	GENE.4197
seq.98	GENE.8763
seq.99	GENE.19573
seq.100	GENE.18830
$ wc -l simulated_reads_indels_testbeers.txt
36131 simulated_reads_indels_testbeers.txt
$ head -2 simulated_reads_indels_testbeers.txt
chr1:6052304-6052531	25	1	G
chr2:73899436-73899622	141	3	ATA
$ tail -2 simulated_reads_indels_testbeers.txt
chr4:68619532-68621804	1298	-2	AA
chr21:32554738-32554962	174	1	T
$ wc -l simulated_reads_substitutions_testbeers.txt 
71678  simulated_reads_substitutions_testbeers.txt
$ head -2 simulated_reads_substitutions_testbeers.txt 
chr22:50902963-50903167	50903077	G->A
chr1:6052304-6052531	6052330	G->C
$ wc -l simulated_reads_junctions-crossed_testbeers.txt 
49   simulated_reads_junctions-crossed_testbeers.txt
$ head -2 simulated_reads_junctions-crossed_testbeers.txt 
seq.1a	chrX:49084601-49084713
seq.1b	chrX:49084909-49086682

$ cat beers_output/simulated_reads_testbeers.log
Simulator run: 'testbeers'
started: Thu Mar 16 15:25:39 EDT 2017
num reads: 100
readlength: 100
substitution frequency: 0.001
indel frequency: 0.0005
base error: 0.005
low quality tail length: 10
percent of tails that are low quality: 0
quality of low qulaity tails: 0.8
percent of alt splice forms: 0.2
number of alt splice forms per gene: 2
stem: refseq
sum of gene counts: 3,886,863,063
sum of intron counts = 1,304,815,198
sum of intron counts = 2,365,472,596
intron frequency: 0.355507598105262
padded intron frequency: 0.52453796437909
finished at Thu Mar 16 15:25:58 EDT 2017

$ wc -l simulated_reads_testbeers.fa
400 simulated_reads_testbeers.fa
$ head simulated_reads_testbeers.fa
>seq.1a
CGAAGAAGGACCCAAAGATGACAAGGCTCACAAAGTACACCCAGGGCAGTTCATACCCCATGGCATCTTGCATCCAGTAGAGCACATCGGTCCAGCCTTC
>seq.1b
GCTCGAGCTGTTCCTTGGACGAATGCACAAGACGTGCTACTTCCTGGGATCCGACATGGAAGCGGAGGAGGACCCATCGCCCTGTGCATCTTCGGGATCA
>seq.2a
GCCCCAGCAGAGCCGGGTAAAGATCAGGAGGGTTAGAAAAAATCAGCGCTTCCTCTTCCTCCAAGGCAGCCAGACTCTTTAACAGGTCCGGAGGAAGCAG
>seq.2b
ATGAAGCCTTTTCCCATGGAGCCATATAACCATAATCCCTCAGAAGTCAAGGTCCCAGAATTCTACTGGGATTCTTCCTACAGCATGGCTGATAACAGAT
>seq.3a
CCCCAGAGGAGCGCCACCTGTCCAAGATGCAGCAGAACGGCTACGAAAATCCAACCTACAAGTTCTTTGAGCAGATGCAGAACTAGACCCCCGCCACAGC

# Take a look at the true coordinates
$ head -4 simulated_reads_testbeers.bed # one-based coords and contains both endpoints of each span
chrX	49084529	49084601	+
chrX	49084713	49084739	+
chrX	49084863	49084909	+
chrX	49086682	49086734	+
$ head -4 simulated_reads_testbeers.cig # has a cigar string representation of the mapping coordinates, and a more human readable representation of the coordinates
seq.1a	chrX	49084529	73M111N27M	49084529-49084601, 49084713-49084739	+	CGAAGAAGGACCCAAAGATGACAAGGCTCACAAAGTACACCCAGGGCAGTTCATACCCCATGGCATCTTGCATCCAGTAGAGCACATCGGTCCAGCCTTC
seq.1b	chrX	49084863	47M1772N53M	49084863-49084909, 49086682-49086734	-	GCTCGAGCTGTTCCTTGGACGAATGCACAAGACGTGCTACTTCCTGGGATCCGACATGGAAGCGGAGGAGGACCCATCGCCCTGTGCATCTTCGGGATCA
seq.2a	chr1	183516256	100M	183516256-183516355	-	GCCCCAGCAGAGCCGGGTAAAGATCAGGAGGGTTAGAAAAAATCAGCGCTTCCTCTTCCTCCAAGGCAGCCAGACTCTTTAACAGGTCCGGAGGAAGCAG
seq.2b	chr1	183515275	100M	183515275-183515374	+	ATGAAGCCTTTTCCCATGGAGCCATATAACCATAATCCCTCAGAAGTCAAGGTCCCAGAATTCTACTGGGATTCTTCCTACAGCATGGCTGATAACAGAT
$ wc -l simulated_reads_testbeers.fa
400 simulated_reads_testbeers.fa
$ wc -l simulated_reads_testbeers.bed
247 simulated_reads_testbeers.bed
$ wc -l simulated_reads_testbeers.cig
200 simulated_reads_testbeers.cig

Flux Sammeth 2010

SimNGS

SimSeq

Bioinformatics

A data-based simulation algorithm for rna-seq data. The vector of read counts simulated for a given experimental unit has a joint distribution that closely matches the distribution of a source rna-seq dataset provided by the user.

empiricalFDR.DESeq2

http://biorxiv.org/content/early/2014/12/05/012211

The key function is simulateCounts, which takes a fitted DESeq2 data object as an input and returns a simulated data object (DESeq2 class) with the same sample size factors, total counts and dispersions for each gene as in real data, but without the effect of predictor variables.

Functions fdrTable, fdrBiCurve and empiricalFDR compare the DESeq2 results obtained for the real and simulated data, compute the empirical false discovery rate (the ratio of the number of differentially expressed genes detected in the simulated data and their number in the real data) and plot the results.

polyester

http://biorxiv.org/content/early/2014/12/05/012211

Given a set of annotated transcripts, polyester will simulate the steps of an RNA-seq experiment (fragmentation, reverse-complementing, and sequencing) and produce files containing simulated RNA-seq reads.

Input: reference FASTA file (containing names and sequences of transcripts from which reads should be simulated) OR a GTF file denoting transcript structures, along with one FASTA file of the DNA sequence for each chromosome in the GTF file.

Output: FASTA files. Reads in the FASTA file will be labeled with the transcript from which they were simulated.

Too many dependencies. Got an error in installation.. It seems it has not considered splice junctions.

seqgendiff

Data-based RNA-seq simulations by binomial thinning

Simulate DNA-Seq

wgsim

https://github.com/lh3/wgsim

dwgssim

NEAT

DNA aligner accuracy: BWA, Bowtie, Soap and SubRead tested with simulated reads

http://genomespot.blogspot.com/2014/11/dna-aligner-accuracy-bwa-bowtie-soap.html

$ head simDNA_100bp_16del.fasta
>Pt-0-100
TGGCGAACGCGGGAATTGACCGCGATGGTGATTCACATCACTCCTAATCCACTTGCTAATCGCCCTACGCTACTATCATTCTTT
>Pt-10-110
GCGGGATTGAACCCGATTGAATTCCAATCACTGCTTAATCCACTTGCTACATCGCCCTACGTACTATCTATTTTTTTGTATTTC
>Pt-20-120
GAACCCGCGATGAATTCAATCCACTGCTACCATTGGCTACATCCGCCCCTACGCTACTCTTCTTTTTTGTATGTCTAAAAAAAA
>Pt-30-130
TGGTGAATCACAATCACTGCCTAACCATTGGCTACATCCGCCCCTACGCTACACTATTTTTTGTATTGCTAAAAAAAAAAATAA
>Pt-40-140
ACAACACTGCCTAATCCACTTGGCTACTCCGCCCCTAGCTACTATCTTTTTTTGTATTTCTAAAAAAAAAAAATCAATTTCAAT

Simulate Whole genome

Simulate whole exome

SCSIM

SCSIM: Jointly simulating correlated single-cell and bulk next-generation DNA sequencing data

Variant simulator

sim1000G: a user-friendly genetic variant simulator in R for unrelated individuals and family-based designs

Mutation-Simulator

Mutation-Simulator

SigProfilerSimulator

Generating realistic null hypothesis of cancer mutational landscapes using SigProfilerSimulator

Convert FASTA to FASTQ

It is interesting to note that the simulated/generated FASTA files can be used by alignment/mapping tools like BWA just like FASTQ files.

If we want to convert FASTA files to FASTQ files, use https://code.google.com/archive/p/fasta-to-fastq/. The quality score 'I' means 40 (the highest) by Sanger (range [0,40]). See https://en.wikipedia.org/wiki/FASTQ_format. The Wikipedia website also mentions FASTQ read simulation tools and a comparison of these tools.

$ cat test.fasta
>Pt-0-50
TGGCGAACGACGGGAATACCCGGAGGTGAATTCAAATCCACT
>Pt-10-60
GACGGAATTGAACCCGATGGGATACAATCCACTGCCTTATCC
>Pt-20-70
GAACCCGCGATGGTGTCACAATCCACTCTTAACCATTGCTAC
>Pt-30-80
GGTGAATTCACAATCCACTGCCTTACCACTTGGCTACCCCCT
>Pt-40-90
AATCCACTGCCTTATCCACTGGCTACATCCCTACGCTACTAT
$ perl ~/Downloads/fasta_to_fastq.pl test.fasta
@Pt-0-50
TGGCGAACGACGGGAATACCCGGAGGTGAATTCAAATCCACT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@Pt-10-60
GACGGAATTGAACCCGATGGGATACAATCCACTGCCTTATCC
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@Pt-20-70
GAACCCGCGATGGTGTCACAATCCACTCTTAACCATTGCTAC
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@Pt-30-80
GGTGAATTCACAATCCACTGCCTTACCACTTGGCTACCCCCT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@Pt-40-90
AATCCACTGCCTTATCCACTGGCTACATCCCTACGCTACTAT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

Alternatively we can use just one line of code by awk

$ awk 'BEGIN {RS = ">" ; FS = "\n"} NR > 1 {print "@"$1"\n"$2"\n+"; for(c=0;c<length($2);c++) printf "H"; printf "\n"}' \
   test.fasta > test.fq
$ cat test.fq
@Pt-0-50
TGGCGAACGACGGGAATACCCGGAGGTGAATTCAAATCCACT
+
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
@Pt-10-60
GACGGAATTGAACCCGATGGGATACAATCCACTGCCTTATCC
+
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
@Pt-20-70
GAACCCGCGATGGTGTCACAATCCACTCTTAACCATTGCTAC
+
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
@Pt-30-80
GGTGAATTCACAATCCACTGCCTTACCACTTGGCTACCCCCT
+
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
@Pt-40-90
AATCCACTGCCTTATCCACTGGCTACATCCCTACGCTACTAT
+
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH

Change the 'H' to the quality score value that you need (Depending what phred score scale you are using).

Simulate genetic data

‘Simulating genetic data with R: an example with deleterious variants (and a pun)’

PDX/Xenograft

#!/bin/bash
module load gossamer
xenome index -M 24 -T 16 -P idx \
  -H $HOME/igenomes/Mus_musculus/UCSC/mm9/Sequence/WholeGenomeFasta/genome.fa \
  -G $HOME/igenomes/Homo_sapiens/UCSC/hg19/Sequence/WholeGenomeFasta/genome.fa

RNA-Seq

DNA-Seq

MAF (TCGA, GDC)

DNA Seq Data

NIH

  • Go to SRA/Sequence Read Archiveand type the keywords 'Whole Genome Sequencing human'. An example of the procedures to search whole genome sequencing data from human samples:
    1. Enter 'Whole Genome Sequencing human' in ncbi/sra search sra objects at http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=search_obj
    2. The webpage will return the result in terms of SRA experiments, SRA studies, Biosamples, GEO datasets. I pick SRA studies from Public Access.
    3. The result is sorted by the Accession number (does not take the first 3 letters like DRP into account). The Accession number has a format SRPxxxx. So I just go to the Last page (page 98)
    4. I pick the first one Accession:SRP066837 from this page. The page shows the Study type is whole genome sequence. http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?study=SRP066837
    5. (Important trick) Click the number next to Run. It will show a summary (SRR #, library name, MBases, age, biomaterial provider, isolate and sex) about all samples. http://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP066837
    6. Download the raw data from any one of them (eg SRR2968056). For whole genome, the Strategy is WGS. For whole exome, the Strategy is called WXS.
  • Search the keywords 'nonsynonymous' and 'human' in PMC

Use SRAToolKit instead of wget to download

Don't use the wget command since it requires the specification of right http address.

Downloading SRA data using command line utilities

SRA2R - a package to import SRA data directly into R.

(Method 1) Use the fastq-dump command. For example, the following command (modified from the document will download the first 5 reads and save it to a file called <SRR390728.fastq> (NOT sra format) in the current directory.

/opt/RNA-Seq/bin/sratoolkit.2.3.5-2-ubuntu64/bin/fastq-dump -X 5 SRR390728 -O .
# OR 
/opt/RNA-Seq/bin/sratoolkit.2.3.5-2-ubuntu64/bin/fastq-dump --split-3 SRR390728 # no progress bar

This will download the files in FASTQ format.

(Method 2) If we need to downloading by wget or FTP (works for ‘SRR’, ‘ERR’, or ‘DRR’ series):

wget ftp://ftp-trace.ncbi.nih.gov/sra/sra-instant/reads/ByRun/sra/SRR/SRR304/SRR304976/SRR304976.sra

It will download the file in SRA format. In the case of SRR590795, the sra is 240M and fastq files are 615*2MB.

(Method 3) Download Ubuntu x86_64 tarball from http://downloads.asperasoft.com/en/downloads/8?list

brb@T3600 ~/Downloads $ tar xzvf aspera-connect-3.6.2.117442-linux-64.tar.gz
aspera-connect-3.6.2.117442-linux-64.sh
brb@T3600 ~/Downloads $ ./aspera-connect-3.6.2.117442-linux-64.sh

Installing Aspera Connect

Deploying Aspera Connect (/home/brb/.aspera/connect) for the current user only.
Restart firefox manually to load the Aspera Connect plug-in

Install complete.

brb@T3600 ~/Downloads $ ~/.aspera/connect/bin/ascp -QT -l640M \
  -i ~/.aspera/connect/etc/asperaweb_id_dsa.openssh \
  [email protected]:/sra/sra-instant/reads/ByRun/sra/SRR/SRR590/SRR590795/SRR590795.sra .
SRR590795.sra                                                                           100%  239MB  535Mb/s    00:06
Completed: 245535K bytes transferred in 7 seconds
 (272848K bits/sec), in 1 file.
brb@T3600 ~/Downloads $

Aspera is typically 10 times faster than FTP according to the website. For this case, wget takes 12s while ascp uses 7s.

Note that the URL on the website's is wrong. I got the correct URL from emailing to ncbi help. Google: ascp "[email protected]"

SRAdb package

https://bioconductor.org/packages/release/bioc/html/SRAdb.html

First we install some required package for XML and RCurl.

sudo apt-get update
sudo apt-get install libxml2-dev
sudo apt-get install libcurl4-openssl-dev

and then

source("https://bioconductor.org/biocLite.R")
biocLite("SRAdb")

SRA

The wait is over… NIH’s Public Sequence Read Archive is now open access on the cloud

Only the cancer types with expected cases > 10^5 in the US in 2015 are considered here. http://www.cancer.gov/types/common-cancers

SRA Explorer

SRP056969

SRP066363 - lung cancer

SRP015769 or SRP062882 - prostate cancer

SRP053134 - breast cancer

Look at the MBases value column. It determines the coverage for each run.

SRP050992 single cell RNA-Seq

Used in Design and computational analysis of single-cell RNA-sequencing experiments

Single cell RNA-Seq

SRP040626 or SRP040540 - Colon and rectal cancer

OmicIDX

OmicIDX on BigQuery

Tutorials

See the BWA section.

Whole Exome Seq

Whole Genome Seq

SraRunTable.txt

  1. http://www.ncbi.nlm.nih.gov/sra/?term=SRA059511
  2. http://www.ncbi.nlm.nih.gov/sra/SRX194938[accn] and click SRP004077
  3. http://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP004077 and click Runs from the RHS
  4. http://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP004077 and click RunInfoTable

Note that (For this study, it has 2377 rows)

  • Column A (AssemblyName_s) eg GRCh37
  • Column I (library_name_s) eg
  • column N (header=Run_s) shows all SRR or ERR accession numbers.
  • Column P (Sample_Name)
  • Column Y (header=Assay_Type_s) shows WGS.
  • Column AB (LibraryLayout_s): PAIRED

Predicting gene expression from DNA sequence

Predicting gene expression from DNA sequence using deep learning models

Public Data

Ten Resources for easy access public genomic data 6/7/2023. UCSCXenaTools (TCGA, ICGC, GDC), PharmacoGx, rDGidb, OmicsDI, AnnotationHub, TCGAbiolinks, GenomicDataCommons, cbioportal.

Public data resources and Bioconductor from Bioc2020.

Package name Object class Downloads (Distinct IPs, Jul 2020)
GEOquery SummarizedExperiment 5754
GenomicDataCommons GDCQuery 1154
TCGAbiolinks
curatedTCGAData
RangedSummarizedExperiment
MultiAssayExperimentObjects
2752
275
recount RangedSummarizedExperiment 418
curatedMetagenomicData ExperimentHub 224

Caution

Public RNA-seq data are not representative of global human diversity 2024

ISB Cancer Genomics Cloud (ISB-CGC)

https://isb-cgc.appspot.com/ Leveraging Google Cloud Platform for TCGA Analysis

The ISB Cancer Genomics Cloud (ISB-CGC) is democratizing access to NCI Cancer Data (TCGA, TARGET, CCLE) and coupling it with unprecedented computational power to allow researchers to explore and analyze this vast data-space.

ISB-CGC Web Application

CCLE, DepMap

  • Next-generation characterization of the Cancer Cell Line Encyclopedia 2019
  • It has 1000+ cell lines profiled with different -omics including DNA methylation, RNA splicing, as well as some proteomics (and lots more!).
  • Assembling Clinical Information for the CCLE Data
  • Data download Depmap
  • Dependency Map (DepMap) portal is to empower the research community to make discoveries related to cancer vulnerabilities by providing open access to key cancer dependencies analytical and visualization tools CCLE
    • sample_info.csv also available from the download page
    • CCLE_RNAseq_reads.csv: read counts from RSEM. 1406 x (54358 - 1). Use readr::read_csv(). range(x[, -1]) = 0 13018000. Note: log2(13018000) = 23.634.
    • CCLE_expression_full.csv: log2(TPM + 1). 1406 x (53971 - 1). range(x[, -1]) = 0.00000 17.78354
    • CCLE_expression.csv: log2(TPM+1). 1406 x 19221 genes. protein coding genes. 33 diseases.
    • CCLE_expression_proteincoding_genes_expected_count.csv: 1406 x (19222 - 1). read count (non-integers) data from RSEM for just protein coding genes. range(x[, -1]) = 0 13018000.
    • CCLE_expression_transcripts_expected_count.csv: read count data from RSEM. 1406 x (228138-1). Non-integers. range(x[, -1]) = 0 11664000.
  • depmap package: Cancer Dependency Map Data Package. The depmap package currently contains eight (kinds) datasets available through ExperimentHub.
    • RNA inference knockout data
    • CRISPR-Cas9 knockout data
    • WES copy number data
    • CCLE Reverse Phase Protein Array data
    • CCLE RNAseq gene expression data
    • Cancer cell lines
    • Mutation calls
    • Drug Sensitivity
    R> eh <- ExperimentHub()
    R> class(eh)
    [1] "ExperimentHub"
    attr(,"package")
    [1] "ExperimentHub"
    
    R> rnai <- eh[["EH2260"]]
    R> class(rnai)
    [1] "tbl_df"     "tbl"        "data.frame"
    

NCI's Genomic Data Commons (GDC)/TCGA

The GDC supports several cancer genome programs at the NCI Center for Cancer Genomics (CCG), including The Cancer Genome Atlas (TCGA), Therapeutically Applicable Research to Generate Effective Treatments (TARGET), and the Cancer Genome Characterization Initiative (CGCI).

GenomicDataCommons package

NCI60

Molecular Characterization of the NCI-60. NCI-ADR-RES and OVCAR-8 being derived from one another, SNB-19 and U251 are derived from the same patient

Case studies

Expression of the SARS-CoV-2 cell receptor gene ACE2 in a wide variety of human tissues

NCI Proteomic Data Commons

https://pdc.cancer.gov/pdc/ vs https://gdc.cancer.gov/

GTEx

NIH LINCS

Sharing data

Gene set analysis

Hypergeometric test

Next-generation sequencing data

Forums

Batch effect

Batch effect

Misc

Advice

High Performance

Cloud Computing

Merge different datasets (different genechips)

Genomic data vs transcriptomic data

  • The main difference between genomic data and transcriptomic data is that genomic data provides information on the complete DNA sequence of an organism, while transcriptomic data provides information on the expression levels of genes.
  • Genomic data:
    • Genomic data refers to the complete DNA sequence of an organism, which includes all of its genes, regulatory regions, and non-coding regions. This type of data provides information on the genetic makeup of an organism, including its potential to develop certain diseases, its evolutionary history, and its overall genetic diversity.
    • Examples of genomic data: Whole genome sequencing (WGS), Genome-wide association studies (GWAS), Copy number variation (CNV) analysis, Comparative genomics, Metagenomics.
  • Transcriptomic data
    • Transcriptomic data, on the other hand, refers to the collection of all RNA transcripts produced by the genes of an organism. RNA transcripts are produced when genes are transcribed into RNA molecules, which are then used as templates to synthesize proteins. Transcriptomic data provides information on the expression levels of genes, which can help researchers understand how genes are regulated and how they contribute to biological processes.
    • Examples of transcriptomic data: RNA-Seq, Microarray, scRNA-Seq, qPCR, Ribosome profiling

Low read count and filtering

  • DESeq2 pre-filtering:
    • While it is not necessary to pre-filter low count genes before running the DESeq2 functions, there are two reasons which make pre-filtering useful: by removing rows in which there are very few reads, we reduce the memory size of the dds data object, and we increase the speed of the transformation and testing functions within DESeq2. DESeq2 vignette.
    • One can also omit this step entirely and just rely on the independent filtering procedures available in results(), either IHW or genefilter::filtered_p().
smallestGroupSize <- 3 # smallest group size
keep <- rowSums(counts(dds) >= 10) >= smallestGroupSize
dds <- dds[keep, ]

Independent Filtering

edgeR::filterByExpr

Normalization

log2 transformation

No matter we use TPM, TMM, FPKM, or DESeq2 normalized counts, we still need to take a log2(x+1) transformation before any analyses.

Quantile normalization

  • normalize.quantiles() from preprocessCore package. How to Perform Quantile Normalization in R
    • for ties, the average is used in normalize.quantiles(), ((4.666667 + 5.666667) / 2) = 5.166667.
    • I got into an error when I use the function in RStudio docker container but the solution here (BiocManager::install("preprocessCore", configure.args="--disable-threading")) works.
    source('http://bioconductor.org/biocLite.R')
    biocLite('preprocessCore')
    #load package
    library(preprocessCore)
     
    #the function expects a matrix
    #create a matrix using the same example
    mat <- matrix(c(5,2,3,4,4,1,4,2,3,4,6,8),
                 ncol=3)
    mat
    #     [,1] [,2] [,3]
    #[1,]    5    4    3
    #[2,]    2    1    4
    #[3,]    3    4    6
    #[4,]    4    2    8
     
    #quantile normalisation
    normalize.quantiles(mat)
    #         [,1]     [,2]     [,3]
    #[1,] 5.666667 5.166667 2.000000
    #[2,] 2.000000 2.000000 3.000000
    #[3,] 3.000000 5.166667 4.666667
    #[4,] 4.666667 3.000000 5.666667

Distribution, density plot

Density plot showing the distribution of RNA-seq read counts (FPKM) log10(FPKM)

Negative binomial distribution

RNA-seq and Negative binomial distribution

Z-score transformation

Ensembl to gene symbol

How to use UCSC Table Browser

File:Tablebrowser.png File:Tablebrowser2.png

Note

  1. the UCSC browser will return the output on browser by default. Users need to use the browser to save the file with self-chosen file name.
  2. the output does not have a header
  3. The bed format is explained in https://genome.ucsc.edu/FAQ/FAQformat.html#format1

If I select "Whole Genome", I will get a file with 75,893 rows. If I choose "Coding Exons", I will get a file with 577,387 rows.

$ wc -l hg38Tables.bed 
75893 hg38Tables.bed
$ head -2 hg38Tables.bed 
chr1	67092175	67134971	NM_001276352	0	-	67093579	67127240	0	9	1429,70,145,68,113,158,92,86,42,	0,4076,11062,19401,23176,33576,34990,38966,42754,
chr1	201283451	201332993	NM_000299	0	+	201283702	201328836	0	15	453,104,395,145,208,178,63,115,156,177,154,187,85,107,2920,	0,10490,29714,33101,34120,35166,36364,36815,38526,39561,40976,41489,42302,45310,46622,
$ tail -2 hg38Tables.bed 
chr22_KI270734v1_random	131493	137393	NM_005675	0	+	131645	136994	0	5	262,161,101,141,549,	0,342,3949,4665,5351,
chr22_KI270734v1_random	138078	161852	NM_016335	0	-	138479	161586	0	15	589,89,99,176,147,93,82,80,117,65,150,35,209,313,164,	0,664,4115,5535,6670,6925,8561,9545,10037,10335,12271,12908,18210,23235,23610,

$ wc -l hg38CodingExon.bed 
577387 hg38CodingExon.bed
$ head -2 hg38CodingExon.bed 
chr1	67093579	67093604	NM_001276352_cds_0_0_chr1_67093580_r	0	-
chr1	67096251	67096321	NM_001276352_cds_1_0_chr1_67096252_r	0	-
$ tail -2 hg38CodingExon.bed 
chr22_KI270734v1_random	156288	156497	NM_016335_cds_12_0_chr22_KI270734v1_random_156289_r	0	-
chr22_KI270734v1_random	161313	161586	NM_016335_cds_13_0_chr22_KI270734v1_random_161314_r	0	-

# Focus on one NCBI refseq (https://www.ncbi.nlm.nih.gov/nuccore/444741698)
$ grep NM_001276352 hg38Tables.bed 
chr1	67092175	67134971	NM_001276352	0	-	67093579	67127240	0	9	1429,70,145,68,113,158,92,86,42,	0,4076,11062,19401,23176,33576,34990,38966,42754,
$ grep NM_001276352 hg38CodingExon.bed
chr1	67093579	67093604	NM_001276352_cds_0_0_chr1_67093580_r	0	-
chr1	67096251	67096321	NM_001276352_cds_1_0_chr1_67096252_r	0	-
chr1	67103237	67103382	NM_001276352_cds_2_0_chr1_67103238_r	0	-
chr1	67111576	67111644	NM_001276352_cds_3_0_chr1_67111577_r	0	-
chr1	67115351	67115464	NM_001276352_cds_4_0_chr1_67115352_r	0	-
chr1	67125751	67125909	NM_001276352_cds_5_0_chr1_67125752_r	0	-
chr1	67127165	67127240	NM_001276352_cds_6_0_chr1_67127166_r	0	-

This can be compared to refGene(?) directly downloaded via http

$ wget -c -O hg38.refGene.txt.gz http://hgdownload.soe.ucsc.edu/goldenPath/hg38/database/refGene.txt.gz
--2018-10-09 15:44:43--  http://hgdownload.soe.ucsc.edu/goldenPath/hg38/database/refGene.txt.gz
Resolving hgdownload.soe.ucsc.edu (hgdownload.soe.ucsc.edu)... 128.114.119.163
Connecting to hgdownload.soe.ucsc.edu (hgdownload.soe.ucsc.edu)|128.114.119.163|:80... connected.
HTTP request sent, awaiting response... 200 OK
Length: 7457957 (7.1M) [application/x-gzip]
Saving to: ‘hg38.refGene.txt.gz’

hg38.refGene.txt.gz                100%[===============================================================>]   7.11M   901KB/s    in 10s

2018-10-09 15:44:54 (708 KB/s) - ‘hg38.refGene.txt.gz’ saved [7457957/7457957]

$ zcat hg38.refGene.txt.gz | wc -l
75893
15:45PM /tmp$ zcat hg38.refGene.txt.gz | head -2
1072	NM_003288	chr20	+	63865227	63891545	63865365	63889945	7	63865227,63869295,63873667,63875815,63882718,63889189,63889849,	63865384,63869441,63873816,63875875,63882820,63889238,63891545,	0	TPD52L2	cmpl	cmpl	0,1,0,2,2,2,0,
1815	NR_110164	chr2	+	161244738	161249050	161249050	161249050	2	161244738,161246874,	161244895,161249050,	0	LINC01806	unk	unk	-1,-1,

$ zcat hg38.refGene.txt.gz | tail -2
1006	NM_130467	chrX	+	55220345	55224108	55220599	55224003	5	55220345,55221374,55221766,55222620,55223986,	55220651,55221463,55221875,55222746,55224108,	0	PAGE5	cmpl	cmpl	0,1,0,1,1,
637	NM_001364814	chrY	-	6865917	6874027	6866072	6872608	7	6865917,6868036,6868731,6868867,6870005,6872554,6873971,	6866078,6868462,6868776,6868909,6870053,6872620,6874027,	0	AMELY	cmpl	cmpl	0,0,0,0,0,0,-1,

Where to download reference genome

Which human reference genome to use?

http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use (11/13/2017)

UHR, HBR

In RNA sequencing (RNA-seq), Universal Human Reference (UHR) and Human Brain Reference (HBR) are two types of commercially available RNA samples that are often used as control samples and assess the performance and accuracy of RNA-seq assays. See this (github) and Lesson 13: Aligning raw sequences to reference genome.

GENCODE transcript database

RefSeq categories

See Table 1 of Chapter 18The Reference Sequence (RefSeq) Database.

Category Description
NC Complete genomic molecules
NG Incomplete genomic region
NM mRNA
NR ncRNA
NP Protein
XM predicted mRNA model
XR predicted ncRNA model
XP predicted Protein model (eukaryotic sequences)
WP predicted Protein model (prokaryotic sequences)

UCSC version & NCBI release corresponding

Gene Annotation

library(rtracklayer)
genes <- readGFF("gencode.v27.annotation.gff3.gz")
genes[1:2, 1:5]
# DataFrame with 2 rows and 5 columns
#      seqid   source       type     start       end
#   <factor> <factor>   <factor> <integer> <integer>
# 1     chr1   HAVANA gene           11869     14409
# 2     chr1   HAVANA transcript     11869     14409
genes[1:100, ] %>% filter(type == "gene") %>% dim()
# Error in UseMethod("filter") :
#   no applicable method for 'filter' applied to an object of class "c('DFrame', 'DataFrame', 'RectangularData', 'SimpleList', 'DataFrame_OR_NULL', 'List', 'Vector', 'list_OR_List', 'Annotated', 'vector_OR_Vector')"

library(ape)
genes2 <- read.gff("gencode.v27.annotation.gff3.gz")
genes2[1:2, 1:5]
#   seqid source       type start   end
# 1  chr1 HAVANA       gene 11869 14409
# 2  chr1 HAVANA transcript 11869 14409
genes2[1:100,]  %>% filter(type == "gene") %>% dim()
# [1] 11  9

Genecards

  • https://www.genecards.org/
  • Q: What are genes with gene symbols starting with LINC?; eg LINC00491
    A: Genes with gene symbols starting with "LINC" are long intergenic non-coding RNA (lncRNA) genes. lncRNAs are RNA molecules that are transcribed from the genome but do not encode proteins. Unlike protein-coding genes, lncRNAs do not have a well-defined coding sequence, but they do play important regulatory roles in cellular processes such as gene expression, chromatin structure, and genome stability. Some lncRNAs are specifically expressed in cancer cells and have been implicated in tumor development and progression, making them of interest for cancer research.

How many DNA strands are there in humans?

How many base pairs in human

  • 3 billion base pairs. https://en.wikipedia.org/wiki/Human_genome
  • chromosome 22 has the smallest number of bps (~50 million).
  • chromosome 1 has the largest number of bps (245 million base pairs).
  • Illumina iGenome Homo_sapiens/UCSC/hg19/Sequence/WholeGenomeFasta/genome.fa file is 3.0GB (so is other genome.fa from human).

Gene, Transcript, Coding/Non-coding exon

SNP

Types of SNPs and number of SNPs in each chromosomes

NGS technology

DNA methylation, Epigenetics

  • Relation of methylation genes and gene expression
    • Methylation of genes can have different effects on gene expression, depending on where the methylation occurs in the gene and the specific context of the gene and the cellular environment. Generally, methylation of promoter regions of genes is associated with reduced gene expression, whereas methylation of gene body regions is less clearly associated with gene expression changes.
    • When DNA is methylated at the promoter region of a gene, it can prevent the binding of transcription factors and RNA polymerase, which are necessary for transcription initiation. Methylation at the promoter region can also recruit proteins that block transcription or promote histone modifications that lead to chromatin compaction, further limiting access to the gene for transcriptional machinery.
    • However, methylation in other regions of the gene, such as the gene body, can have more complex effects on gene expression. In some cases, gene body methylation can be associated with increased expression, while in other cases it may have no effect or even lead to decreased expression. It is thought that gene body methylation may be involved in regulating alternative splicing or RNA stability, among other possible mechanisms.
    • Therefore, the effect of methylation on gene expression is not always straightforward and depends on various factors, including the specific gene, the location of methylation, and the cellular context.
devtools::install_github("coloncancermeth","genomicsclass")
library(coloncancermeth) # 485512 x 26
data(coloncancermeth) # load meth (methylation data), pd (sample info ) and gr objects
dim(meth)
dim(pd)
length(gr)
colnames(pd)
table(pd$Status) # 9 normals, 17 cancers
normalIndex <- which(pd$Status=="normal")
cancerlIndex <- which(pd$Status=="cancer")

i=normalIndex[1]
plot(density(meth[,i],from=0,to=1),main="",ylim=c(0,3),type="n")
for(i in normalIndex){
  lines(density(meth[,i],from=0,to=1),col=1)
}
### Add the cancer samples
for(i in cancerlIndex){
  lines(density(meth[,i],from=0,to=1),col=2)
}

# finding regions of the genome that are different between cancer and normal samples
library(limma)
X<-model.matrix(~pd$Status)
fit<-lmFit(meth,X)
eb <- ebayes(fit)

# plot of the region surrounding the top hit
library(GenomicRanges)
i <- which.min(eb$p.value[,2])
middle <- gr[i,]
Index<-gr%over%(middle+10000)
cols=ifelse(pd$Status=="normal",1,2)
chr=as.factor(seqnames(gr))
pos=start(gr)

plot(pos[Index],fit$coef[Index,2],type="b",xlab="genomic location",ylab="difference")
matplot(pos[Index],meth[Index,],col=cols,xlab="genomic location")
# http://www.ncbi.nlm.nih.gov/pubmed/22422453

# within each chromosome we usually have big gaps creating subgroups of regions to be analyzed
chr1Index <- which(chr=="chr1")
hist(log10(diff(pos[chr1Index])),main="",xlab="log 10 method")

library(bumphunter)
cl=clusterMaker(chr,pos,maxGap=500)
table(table(cl)) ##shows the number of regions with 1,2,3, ... points in them
#consider two example regions#
...

Integrate DNA methylation and gene expression

Whole Genome Sequencing, Whole Exome Sequencing, Transcriptome (RNA) Sequencing

Sequence + Expression

Integrate RNA-Seq and DNA-Seq

Immunohistochemistry/IHC

https://en.wikipedia.org/wiki/Immunohistochemistry. Protein expression by IHC.

Deconvolve bulk tumor tissue

Tumor purity

  • Tumor Purity in Preclinical Mouse Tumor Models 2022
  • Systematic Assessment of Tumor Purity and Its Clinical Implications Haider 2020.
    • With the exception of naive miRNA profiles, purity estimates were inversely correlated with molecular profiles regardless of the underlying purity estimation profile .
    • These data suggest that the presence of genomic and transcriptomic correlates of tumor purity are likely to confound biologic and clinical interpretations.
  • Estimators:
    • DNA: ABSOLUTE, ASCAT, CLONET, INTEGER, OncoSNP
    • RNA: DeMix, ISOpure-R (matlab/R), ESTIMATE (Yoshihara, R)
    • miRNA/microRNA: ISOpure-I
  • TCGA purity estimate by Aran 2015 Systematic pan-cancer analysis of tumour purity - Supplementary Data 1 (xlsx file with columns: Sample ID,Cancer type,ESTIMATE,ABSOLUTE,LUMP,IHC & CPE).
  • Tumor.purity: TCGA samples with their Tumor Purity measures (a data frame with 9364 rows and 7 variables) from TCGAbiolinks package
  • Prediction of tumor purity from gene expression data using machine learning 2021.
    • We selected the CPE as the target variable, which is the median purity value after normalizing values from the other four purity estimates (ESTIMATE, ABSOLUTE, LUMP and IHC).
    • our data set consisted of 8405 tumor samples.
  • How VAF is related to tumor purity?
    • Variant allelic fraction (VAF) is related to tumor purity because it reflects the proportion of cells in a sample that carry a specific genetic variant. In the context of cancer, VAF can be used as a surrogate marker for tumor purity, as the fraction of cells in the sample that carry the variant will depend on the proportion of cancer cells relative to normal cells.
    • The VAF of a specific genetic variant in a cancer sample can be calculated as the ratio of the number of reads supporting the variant to the total number of reads covering that locus. In a sample that is purely composed of cancer cells, the VAF should approach 1, as all cells will carry the variant. In a sample that is mixed with normal cells, the VAF will be lower and proportional to the proportion of cancer cells in the sample.
    • Therefore, by measuring the VAF of one or more genetic variants, it is possible to estimate the tumor purity, which is the proportion of cancer cells in the sample relative to normal cells. This information is important for a variety of downstream analyses, including variant calling, gene expression analysis, and the estimation of the mutational burden, as it can affect the interpretation of the results and the accuracy of the analysis.
  • How gene expression can be used to estimate tumor purity?
    • Gene expression analysis can be used to estimate tumor purity by comparing the expression levels of genes known to be specific to either normal or cancer cells. In a sample that is mixed with normal and cancer cells, the expression levels of these genes will reflect the proportion of normal and cancer cells present in the sample.
    • For example, genes that are highly expressed in normal cells, such as housekeeping genes, can be used as a reference to estimate the proportion of normal cells in the sample. Similarly, genes that are highly expressed in cancer cells, such as oncogenes, can be used to estimate the proportion of cancer cells in the sample.
    • The relative expression levels of these genes can then be used to estimate the tumor purity, either by comparing the expression levels to a reference sample of known purity, or by using mathematical models to estimate the proportion of normal and cancer cells in the sample.
    • It is important to note that this method is not without limitations, as the expression levels of specific genes can be influenced by various factors, such as the presence of cell-to-cell heterogeneity, gene amplification, and epigenetic modifications, among others. Therefore, gene expression analysis should be used in combination with other methods, such as copy number analysis and variant allelic fraction analysis, to obtain a more accurate estimate of tumor purity.
  • Some papers
  • ISOpureR (Quon 2013): intensity or count data. Error term [math]\displaystyle{ e_n }[/math] multinomial distribution.
    library(ISOpureR)
    
    # For reproducible results, set the random seed
    set.seed(123);
    
    # Run ISOpureR Step 1 - Cancer Profile Estimation
    system.time(ISOpureS1model <- ISOpure.step1.CPE(
      tumor.expression.data,  # intensity or count data
      normal.expression.data  # intensity or count data 
    ))
    ISOpureS1model$alphapurities  # tumor purity estimates
    
  • ESTIMATE (Yoshihara 2013): normalized data.
    • Since it is based ssGSEA, only ranks are used. It does not matter we used the log transformed or count data.
    • ssGSEA is based on two gene signatures: Stromal signature (141 genes) and immune signature (141 genes)
    • The formula for calculating ESTIMATE tumor purity was developed in TCGA Affymetrix data (n=1001) including both the ESTIMATE score and ABSOLUTE-based tumor purity.
    • An evolutionary algorithm was used for the mathematical model.
    • Nonlinear least squares method was used to determine the final model estimate.
    • Tumor purity = cos(0.6 + 0.000146 * ESTIMATE score)
    library(estimate)
    OvarianCancerExpr <- system.file("extdata", "sample_input.txt", package="estimate")
    filterCommonGenes(input.f=OvarianCancerExpr, output.f="OV_10412genes.gct", id="GeneSymbol")
    estimateScore("OV_10412genes.gct", "OV_estimate_score.gct", platform="affymetrix")
    
    plotPurity(scores="OV_estimate_score.gct", samples="s516", platform="affymetrix")
    
    scan("OV_estimate_score.gct", "", skip=6)[-c(1:2)] |> as.numeric() # tumor purity estimates
    
  • DeMixT (Wang 2018): count data. Estimation of tumor cell total mRNA expression in 15 cancer types predicts disease progression, Cao 2022 for profile likelihood method & supplementary information for more information about the benchmarking between DeMixT_DE and DeMixT_GS.
    library(DeMixT)
    source("DeMixT_preprocessing.R")
    
    count.mat <- cbind(normal.expression.data, tumor.expression.data)
    colnames(count.mat) <- paste0("sample", 1:ncol(count.mat))
    
    label = factor(c(rep('Normal', ncol(normal.expression.data)),
                     rep('Tumor', ncol(tumor.expression.data))))
    set.seed(1234) # not sure if this is needed
    preprocessed_data = DeMixT_preprocessing(count.mat, label)
    PRAD_filter = preprocessed_data$count.matrix
    
    set.seed(1234)
    Normal.id <- paste0("sample", 1:n1)
    Tumor.id <- paste0("sample", (n1+1):(n1+n2))
    data.Y = SummarizedExperiment(assays = list(counts = PRAD_filter[, Tumor.id]))
    data.N1 <- SummarizedExperiment(assays = list(counts = PRAD_filter[, Normal.id]))
    res = DeMixT(data.Y = data.Y,
                 data.N1 = data.N1,
                 nthread = 64,
                 gene.selection.method = "DE") # default is "GS"
    res$pi[2, ] # tumor purity estimates
    
  • CIBERSORTx (Newman 2019). Web only. Determining cell type abundance and expression from bulk tissues with digital cytometry
  • PUREE (Revkov 2023). Python-based. Only API, no source code.

Integrate/combine Omics

Gene expression

Expression level is the amount of RNA in cell that was transcribed from that gene. Slides from Alyssa Frazee.

Fusion gene

Structural variation

LUMPY, DELLY, ForestSV, Pindel, breakdancer , SVDetect.

Covid-19

Bulk RNA sequencing for analysis of post COVID-19 condition 2024. 13 differentially expressed genes associated with PCC (long Covid) were found. Enriched pathways were related to interferon-signalling and anti-viral immune processes.

RNASeq + ChipSeq

Labs

Biowulf2 at NIH

BamHash

Hash BAM and FASTQ files to verify data integrity. The C++ code is based on OpenSSL and seqan libraries.

Reproducibility

Selected Papers

Pictures

https://www.flickr.com/photos/genomegov

FISH/Fluorescence In Situ Hybridization

用DNA做身分鑑識

用DNA做身分鑑識

如何自学入门生物信息学

CRISPR

基因編輯的原理是什麼?一次看懂基因神剪CRISPR

Staying current

Staying Current in Bioinformatics & Genomics: 2017 Edition

Papers

Common issues in algorithmic bioinformatics papers

What are some common issues I find when reviewing algorithmic bioinformatics conference papers?

Precision Medicine courses

Personalized medicine

Cancer and gene markers

  • Colorectal cancer patients without KRAS mutations have far better outcomes with EGFR treatment than those with KRAS mutations.
    • Two EGFR inhibitors, cetuximab and panitumumab are not recommended for the treatment of colorectal cancer in patients with KRAS mutations in codon 12 and 13.
  • Breast cancer.

The shocking truth about space travel

7 percent of DNA belonging to NASA astronaut Scott Kelly changed in the time he was aboard the International Space Station

bioSyntax: syntax highlighting for computational biology

https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2315-y

Deep learning

Deep learning: new computational modelling techniques for genomics

HRD/homologous recombination deficiency 同源重组修复缺陷

  • https://en.wikipedia.org/wiki/Homologous_recombination
    • Homologous recombination proficient (HRP) cancer cells can repair DNA damage caused by chemotherapy, making them difficult to treat.
    • drugs have been developed to target homologous recombination via c-Abl inhibition and to exploit (take advantage of) deficiencies in homologous recombination in cancer cells with BRCA mutations.
    • One such drug is Olaparib, a PARP1 inhibitor that targets cancer cells by inhibiting base-excision repair (BER) in HR-deficient cells. However, cancer cells can become resistant to PARP1 inhibitors if they undergo deletions of mutations in BRCA2, restoring their ability to repair DNA by HR.
  • https://www.genome.gov/genetics-glossary/homologous-recombination (graphical illustration). Homologous recombination is a type of genetic recombination in which nucleotide sequences are exchanged between two similar or identical molecules of DNA.
  • BRCA1 and BRCA2 are genes that produce proteins responsible for repairing damaged DNA within cells. Mutations in these genes can lead to errors in the DNA repair process, resulting in an accumulation of mutations that can cause cancer. This condition is known as Homologous Recombination Deficiency (HRD). PARP inhibitors are a type of targeted therapy that blocks the enzyme Poly (ADP-ribose) polymerase (PARP), which helps repair DNA damage in (cancer) cells. By inhibiting PARP, these drugs prevent cancer cells from repairing their DNA, leading to cell death.
  • The inability to repair DNA damage is referred to as homologous recombination deficiency (HRD). DNA damage response from Qiagen.
  • FDA approved for HRD assessment: 1) Foundation Medicine's FoundationOne CDx in 2020, 2) Myriad myChoice CDx in 2019. PS:
    • CDx stands for Companion Diagnostic. They help identify patients who might benefit from specific treatments, particularly in the context of certain cancer therapies. In the case of HRD (Homologous Recombination Deficiency) assessment, these CDx tests help identify patients who might respond well to PARP inhibitors or other targeted therapies.
    • In the case of HRD (Homologous Recombination Deficiency) assessment, these CDx tests help identify patients who might respond well to PARP inhibitors or other targeted therapies.
  • How HRD and PARP inhibitors relate:
    • Cancer cells with HRD are already struggling to repair DNA damage.
    • When these cells are treated with PARP inhibitors, it becomes even harder for them to repair DNA damage.
    • This combination can lead to cancer cell death, a concept known as "synthetic lethality."
    • In other words, PARP inhibitors (PARPi) are primarily used in patients who are HRD-positive.
  • Role of CDx tests in HRD assessment:
    • These tests analyze tumor samples for signs of HRD.
    • They may look for specific gene mutations (like BRCA1/2) or broader genomic patterns indicative of HRD.
    • The results help predict whether a patient's cancer is likely to respond to PARP inhibitors.
  • Clinical implications:
    • Patients who test positive for HRD are more likely to benefit from PARP inhibitors.
    • Those without HRD might be better suited for other treatment options.
  • Beyond PARP inhibitors:
    • HRD status can also inform the use of platinum-based chemotherapies and potentially other DNA-damaging agents.
  • Cancer types:
    • This approach is particularly relevant in ovarian, breast, prostate, and pancreatic cancers, among others.
  • openai
    • Poly(ADP-ribose) polymerase (PARP) inhibitors are a class of drugs that are designed to inhibit the activity of PARP enzymes. PARP enzymes are proteins that are involved in DNA repair pathways. They help to repair DNA damage and maintain the stability of the genome by adding a chemical group called poly(ADP-ribose) to other proteins.
    • PARP inhibitors work by blocking the activity of PARP enzymes, which can interfere with the ability of cells to repair damaged DNA. This can be especially useful in cancer cells, which often rely on PARP enzymes to repair DNA damage and maintain genomic stability. By inhibiting PARP enzymes, PARP inhibitors can sensitizize cancer cells to chemotherapy and other treatments, making them more vulnerable to cell death.
    • is there drug targeting HRP cancer patients? One approach is to target homologous recombination via c-Abl inhibition. For example, Niraparib is a PARP inhibitor that has been shown to be effective in treating advanced ovarian cancer in both homologous recombination deficient (HRD) and homologous recombination proficient (HRP) patients.
    • is there any drugs target HRD cancer patients? Yes, there are several drugs that have been developed to target HRD cancer cells. One approach is to use PARP inhibitors, which exploit deficiencies in homologous recombination in cancer cells with BRCA mutations. For example, Olaparib is a PARP1 inhibitor that has been shown to be effective in shrinking or stopping the growth of tumors from breast, ovarian and prostate cancers caused by mutations in the BRCA1 or BRCA2 genes. By inhibiting base-excision repair (BER) in HR-deficient cells, Olaparib applies the concept of synthetic lethality to specifically target cancer cells. PS: Examples of PARP inhibitors include niraparib (Zejula), olaparib (Lynparza), talazoparib (Talzenna), and rucaparib (Rubraca).
    • PARP1 is a member of the PARP family of proteins. PARP stands for Poly (ADP-ribose) polymerase. The PARP family comprises 17 members.
  • Loss-of-function genes involved in this pathway can sensitize tumors to poly(adenosine diphosphate [ADP]-ribose) polymerase (PARP) inhibitors and platinum-based (Pt) chemotherapy
    • Certain genes that are involved in a process called Homologous Recombination Repair (HRR) can make cancer cells more susceptible to certain treatments. Specifically, it says that when these loss-of-function genes are present, the cancer cells become more sensitive to two types of chemotherapy: PARP inhibitors and platinum-based chemotherapy.
    • Loss-of-function genes are genes that have mutations that prevent them from functioning properly or at all. By disrupting the normal functioning of the HRR pathway, these loss-of-function genes can make cancer cells more sensitive to PARP inhibitors and platinum-based chemotherapy.
  • scarHRD package. Note for the 2 test samples, the return object is a 1x4 matrix.
    • HRD-LOH/Loss of Heterozygosity
    • LST/Large Scale Transitions
    • Number of Telomeric Allelic Imbalances
    • HRD-sum (sum of the above 3)
  • Harmonization of homologous recombination deficiency testing in ovarian cancer: Results from the MITO16A/MaNGO-OV2 trial 2024
    • BRCA mutation status: the BRCA status was defined positive (BRCA+) when a clinically significant mutation (pathogenic/likely pathogenic) was found in BRCA genes, and negative (BRCA-) if no clinically significant mutation was found. NOTE: Pathogenicity 致病性 refers to the ability of an organism to cause disease or damage in a host.
    • Genomic instability/GI score (same as HRD score)
    • HRD status
    • Sensitivty, Specificity, Agreement, Cohen kappa are used to compare new assays/tests vs reference test (Myriad)
    • RECIST response rate, PFS, OS

Computational Pathology

Bi-allelic, monoallelic

Bi-allelic and monoallelic expression. In most cases, both alleles (the two chromosomal copies) are transcribed; this is known as bi-allelic expression (left). However, a minority of genes show monoallelic expression (right). In these cases, only one allele of a gene is expressed (right).

SOMAscan assay (proteomic)

Scandal

阿茲海默症關鍵論文被揭發疑似造假,16年來全球醫學專家可能都被呼弄 & 阿茲海默症關鍵論文疑造假 誤導外界16年

Terms

RNA vs DNA

基因结构

https://zhuanlan.zhihu.com/p/49601643

Pseudogene

https://www.genome.gov/genetics-glossary/Pseudogene. An example: OR7E47P with alias bpl 41-16 or bpl41-16.

PCR

什麼是PCR? 聚合酶鏈鎖反應? 基因叔叔

Epidemiology

Epidemiology for the uninitiated

Serum vs plasma

Comparing the MicroRNA Spectrum between Serum and Plasma

Cell lines

in vivo, in vitro, and in situ

In silico 電腦模擬 (in silicon, s=simulation)

  • https://en.wikipedia.org/wiki/In_silico An in silico experiment is one performed on computer or via computer simulation.
  • The main difference between in silico gene expression analysis and experimental gene expression analysis is the method used to study the patterns and levels of gene expression.
    • In silico gene expression analysis involves the use of computational tools and algorithms to analyze large datasets of gene expression data obtained from techniques such as microarrays, RNA sequencing, or single-cell RNA sequencing. This analysis can include identifying differentially expressed genes between samples, clustering genes with similar expression patterns, and predicting the functional roles of genes based on their expression profiles.
    • On the other hand, experimental gene expression analysis involves directly measuring the levels and patterns of gene expression using laboratory techniques. These techniques can include real-time polymerase chain reaction (PCR), northern blotting, western blotting, and immunohistochemistry, among others. These experimental techniques allow researchers to directly measure the levels of specific RNA or protein molecules in biological samples.
    • While in silico gene expression analysis is a rapid and cost-effective way to analyze large datasets of gene expression data, it relies on the accuracy and completeness of the data being analyzed. Experimental gene expression analysis provides a more direct and accurate view of gene expression but can be more time-consuming and expensive. In practice, both in silico and experimental gene expression analysis are valuable tools that can be used to complement each other in the study of gene expression and its role in various biological processes and diseases.
  • In silico gene expression analysis--an overview Murray 2007
  • A simple in silico approach to generate gene-expression profiles from subsets of cancer genomics data 2019

In situ 原處 (介於in vivo與in vitro之間)

  • https://en.wikipedia.org/wiki/In_situ 意義大致介於in vivo與in vitro之間。
  • Something that’s performed in situ means that it’s observed in its natural context, but outside of a living organism. In vivo is Latin for “within the living.” It refers to work that’s performed in a whole, living organism .
  • A good example of this is a technique called in situ hybridization (ISH). ISH can be used to look for a specific nucleic acid (DNA or RNA) within something like a tissue sample. Specialized probes are used to bind to a specific nucleic acid sequence that the researcher is looking to find. These probes are tagged with things like radioactivity or fluorescence. This allows the researcher to see where the nucleic acid is located within the tissue sample. ISH allows the researcher to observe where a nucleic acid is located within its natural context, yet outside of a living organism. Examples are microarray experiments.

in vivo 活体内

Syngenic

Syngeneic tumor models are experimental models used in cancer research that use genetically identical animals to study the growth and spread of cancer cells. In these models, a malignant tumor is induced in one animal and then transplanted into another animal of the same genetic background. This allows researchers to study the interactions between the host immune system and the cancer cells, as well as the response of the tumor to various treatments.

Syngeneic tumor models are often used in combination with other experimental models, such as xenograft models (where the cancer cells are transplanted into a genetically different animal) or cell line models (where the cancer cells are grown in a laboratory). By using a combination of these models, researchers can gain a more complete understanding of the biology of cancer and develop new treatments for cancer patients.

The syngeneic model is an important tool for studying the role of the immune system in cancer, as the genetically identical animals allow researchers to control for genetic differences that might impact the immune response. Additionally, because the host immune system in these models is functional and can mount a response against the transplanted cancer cells, the syngeneic model provides a more realistic representation of the host-tumor interaction than other models that rely on immunodeficient animals.

in vitro 试管内/体外

RUO: research use only

RUO stands for "Research Use Only". In the context of clinical trials and laboratory research, it refers to in vitro diagnostic products (IVDs) that are intended to be used in non-clinical studies, including to gather data for submission as required by regulatory authorities³. These products are not intended for use in diagnostic procedures. They are often used by medical laboratories and other institutions for research purposes. However, if these products are used for purposes other than research, it could have legal implications. It's important to note that RUO products are not subject to the same regulatory controls as in-vitro diagnostic medical devices (CE-IVDs) that must comply with the applicable legal requirements.

RNA sequencing 101

Web

Books

strand-specific vs non-strand specific experiment

Understand this info is necessary when we want to use summarizeOverlaps() function (GenomicAlignments) or htseq-count python program to get count data.

This post mentioned to use infer_experiment.py script to check whether the rna-seq run is stranded or not.

The rna-seq experiment used in this tutorial is not stranded-specific.

FASTQ

  • FASTQ=FASTA + Qual. FASTQ format is a text-based format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores.

Phred quality score

q = -10log10(p) where p = error probability for the base.

q error probability base call accuracy
10 0.1 90%
13 0.05 95%
20 0.01 99%
30 0.001 99.9%
40 0.0001 99.99%
50 0.00001 99.999%

FASTA

fasta/fa files can be used as reference genome in IGV. But we cannot load these files in order to view them.

Download sequence files

Compute the sequence length of a FASTA file

https://stackoverflow.com/questions/23992646/sequence-length-of-fasta-file

awk '/^>/ {if (seqlen){print seqlen}; print ;seqlen=0;next; } { seqlen += length($0)}END{print seqlen}' file.fa

head -2 file.fa | \
    awk '/^>/ {if (seqlen){print seqlen}; print ;seqlen=0;next; } { seqlen += length($0)}END{print seqlen}'  | \
    tail -1

FASTA <=> FASTQ conversion

According to this post,

  • FastA are text files containing multiple DNA* seqs each with some text, some part of the text might be a name.
  • FastQ files are like fasta, but they also have quality scores for each base of each seq, making them appropriate for reads from an Illumina machine (or other brands)

Convert FASTA to FASTQ without quality scores

Biostars. For example, the bioawk by lh3 (Heng Li) worked.

Convert FASTA to FASTQ with quality score file

See the links on the above post.

Convert FASTQ to FASTA using Seqtk

Use the Seqtk program; see this post.

The Seqtk program by lh3 can be used to sample reads from a fastq file including paired-end; see this post.

RPKM (Mortazavi et al. 2008) and cpm (counts per million)

Reads per Kilobase of Exon per Million of Mapped reads.

  • RPKMs can only be calculated for those genes for which the gene length and GC content information is available; see the vignette of GSVA
  • rpkm function in edgeR package.
  • RPKM function in easyRNASeq package.
  • TMM > cpm > log2 transformation on the paper Gene expression profiling of 1200 pancreatic ductal adenocarcinoma reveals novel subtypes
  • Gene expression quantification from RNA-Seq wikipedia page
    • Sequencing depth/coverage: the total number of reads generated in a single experiment is typically normalized by converting counts to fragments, reads, or counts per million mapped reads (FPM, RPM, or CPM).
    • Gene length: FPKM, TPM. Longer genes will have more fragments/reads/counts than shorter genes if transcript expression is the same. This is adjusted by dividing the FPM by the length of a gene, resulting in the metric fragments per kilobase of transcript per million mapped reads (FPKM). When looking at groups of genes across samples, FPKM is converted to transcripts per million (TPM) by dividing each FPKM by the sum of FPKMs within a sample.
  • Difference between CPM and TPM and which one for downstream analysis?. CPM is basically depth-normalized counts whereas TPM is length normalized (and then normalized by the length-normalized values of the other genes).
  • The RNA-seq abundance zoo. The counts per million (CPM) metric takes the raw (or estimated) counts, and performs the first type of normalization I mention in the previous section. That is, it normalized the count by the library size, and then multiplies it by a million (to avoid scary small numbers).
  • See also the log(CPM) implemented in Seurat::NormalizeData() for scRNA-seq data.

Idea

  • The more we sequence, the more reads we expect from each gene. This is the most relevant correction of this method.
  • Longer transcript are expected to generate more reads. The latter is only relevant for comparisons among different genes which we rarely perform!. As such, the DESeq2 only creates a size factor for each library and normalize the counts by dividing counts by a size factor (scalar) for each library. Note that: H0: mu1=mu2 is equivalent to H0: c*mu1=c*mu2 where c is gene length.

Calculation

  1. Count up the total reads in a sample and divide that number by 1,000,000 – this is our “per million” scaling factor.
  2. Divide the read counts by the “per million” scaling factor. This normalizes for sequencing depth, giving you reads per million (RPM)
  3. Divide the RPM values by the length of the gene, in kilobases. This gives you RPKM.

Formula

RPKM = (10^9 * C)/(N * L), with 

C = Number of reads mapped to a gene
N = Total mapped reads in the experiment
L = gene length in base-pairs for a gene
source("http://www.bioconductor.org/biocLite.R")
biocLite("edgeR")
library(edgeR)

set.seed(1234)
y <- matrix(rnbinom(20,size=1,mu=10),5,4)
     [,1] [,2] [,3] [,4]
[1,]    0    0    5    0
[2,]    6    2    7    3
[3,]    5   13    7    2
[4,]    3    3    9   11
[5,]    1    2    1   15

d <- DGEList(counts=y, lib.size=1001:1004)
# Note that lib.size is optional
# By default, lib.size = colSums(counts)
cpm(d) # counts per million
   Sample1   Sample2  Sample3   Sample4
1    0.000     0.000 4985.045     0.000
2 5994.006  1996.008 6979.063  2988.048
3 4995.005 12974.052 6979.063  1992.032
4 2997.003  2994.012 8973.081 10956.175
5  999.001  1996.008  997.009 14940.239
> cpm(d,log=TRUE)
    Sample1   Sample2  Sample3   Sample4
1  7.961463  7.961463 12.35309  7.961463
2 12.607393 11.132027 12.81875 11.659911
3 12.355838 13.690089 12.81875 11.129470
4 11.663897 11.662567 13.17022 13.451207
5 10.285119 11.132027 10.28282 13.890078

d$genes$Length <- c(1000,2000,500,1500,3000)
rpkm(d)
    Sample1   Sample2    Sample3  Sample4
1    0.0000     0.000  4985.0449    0.000
2 2997.0030   998.004  3489.5314 1494.024
3 9990.0100 25948.104 13958.1256 3984.064
4 1998.0020  1996.008  5982.0538 7304.117
5  333.0003   665.336   332.3363 4980.080

> cpm
function (x, ...)
UseMethod("cpm")
<environment: namespace:edgeR>
> showMethods("cpm")

Function "cpm":
 <not an S4 generic function>
> cpm.default
function (x, lib.size = NULL, log = FALSE, prior.count = 0.25,
    ...)
{
    x <- as.matrix(x)
    if (is.null(lib.size))
        lib.size <- colSums(x)
    if (log) {
        prior.count.scaled <- lib.size/mean(lib.size) * prior.count
        lib.size <- lib.size + 2 * prior.count.scaled
    }
    lib.size <- 1e-06 * lib.size
    if (log)
        log2(t((t(x) + prior.count.scaled)/lib.size))
    else t(t(x)/lib.size)
}
<environment: namespace:edgeR>
> rpkm.default
function (x, gene.length, lib.size = NULL, log = FALSE, prior.count = 0.25,
    ...)
{
    y <- cpm.default(x = x, lib.size = lib.size, log = log, prior.count = prior.count)
    gene.length.kb <- gene.length/1000
    if (log)
        y - log2(gene.length.kb)
    else y/gene.length.kb
}
<environment: namespace:edgeR>

Here for example the 1st sample and the 2nd gene, its rpkm value is calculated as

# step 1:
6/(1.0e-6 *1001) = 5994.006    # cpm, compute column-wise
# step 2:
5994.006/ (2000/1.0e3) = 2997.003 # rpkm, compute row-wise

# Another way
# step 1 (RPK) 
6/ (2000/1.0e3) = 3
# step 2 (RPKM)
3/ (1.0e-6 * 1001) = 2997.003

Another example. source code of calc_cpm().

library(edgeR)
set.seed(1234)
y <- matrix(rnbinom(20,size=1,mu=10),5,4)
cpm(y)
#          [,1]   [,2]      [,3]      [,4]
#[1,]      0.00      0 172413.79      0.00
#[2,] 400000.00 100000 241379.31  96774.19
#[3,] 333333.33 650000 241379.31  64516.13
#[4,] 200000.00 150000 310344.83 354838.71
#[5,]  66666.67 100000  34482.76 483870.97

calc_cpm <- function (expr_mat) {
    norm_factor <- colSums(expr_mat)
    return(t(t(expr_mat)/norm_factor) * 10^6)
    # Fix a bug in the original code
    # Not affect silhouette()
}

calc_cpm(y)
#          [,1]   [,2]      [,3]      [,4]
#[1,]      0.00      0 172413.79      0.00
#[2,] 400000.00 100000 241379.31  96774.19
#[3,] 333333.33 650000 241379.31  64516.13
#[4,] 200000.00 150000 310344.83 354838.71
#[5,]  66666.67 100000  34482.76 483870.97

Critics

Consider the following example: in two libraries, each with one million reads, gene X may have 10 reads for treatment A and 5 reads for treatment B, while it is 100x as many after sequencing 100 millions reads from each library. In the latter case we can be much more confident that there is a true difference between the two treatments than in the first one. However, the RPKM values would be the same for both scenarios. Thus, RPKM/FPKM are useful for reporting expression values, but not for statistical testing!

CPM vs TPM

Both has the property that the sumof reads is 1 million(10^6). But TPM includes gene length normalization (TPM accounts for variations in gene length (done first) and sequencing depth (done second)). So if want to find DE genes between samples, it is common to use the TPM normalization method.

(another critic) Union Exon Based Approach

http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0141910

In general, the methods for gene quantification can be largely divided into two categories: transcript-based approach and ‘union exon’-based approach.

It was found that the gene expression levels are significantly underestimated by ‘union exon’-based approach, and the average of RPKM from ‘union exons’-based method is less than 50% of the mean expression obtained from transcript-based approach.

FPKM (Trapnell et al. 2010)

  • Fragment per Kilobase of exon per Million of Mapped fragments (Cufflinks).
  • FPKM is very similar to RPKM. RPKM was made for single-end RNA-seq, where every read corresponded to a single fragment that was sequenced. FPKM was made for paired-end RNA-seq. With paired-end RNA-seq, two reads can correspond to a single fragment, or, if one read in the pair did not map, one read can correspond to a single fragment. The only difference between RPKM and FPKM is that FPKM takes into account that two reads can map to one fragment (and so it doesn’t count this fragment twice).
  • Differential expression analysis with only FPKM matrix available from total newbie in R

Gene length

library(AnnotationHub)
library(airway)
library(SummarizedExperiment)

# Load the airway dataset
data("airway")
counts <- assay(airway)
counts <- as.matrix(counts)  # Ensure it's a matrix

# TPM Calculation Function
compute_tpm <- function(counts, lengths) {
  length_scaled <- counts / lengths
  scaling_factors <- colSums(length_scaled)
  tpm <- t(t(length_scaled) / scaling_factors) * 1e6
  return(tpm)
}

BiocManager::install("biomaRt")  # If not installed yet
library(biomaRt)
# Connect to Ensembl BioMart for human
mart <- useMart("ENSEMBL_MART_ENSEMBL", dataset = "hsapiens_gene_ensembl")
# Fetch gene lengths for human genes
gene_lengths <- getBM(
  attributes = c("ensembl_gene_id", "gene_biotype", "transcript_length"),  # Attribute options
  mart = mart
)

# Make sure to use ENSEMBL IDs (Ensembl Gene IDs) from the airway data
head(gene_lengths)
  ensembl_gene_id   gene_biotype transcript_length
1 ENSG00000210049        Mt_tRNA                71
2 ENSG00000211459        Mt_rRNA               954
3 ENSG00000210077        Mt_tRNA                69

library(TxDb.Hsapiens.UCSC.hg38.knownGene)
# Extract the transcripts
txdb <- TxDb.Hsapiens.UCSC.hg38.knownGene
genes <- genes(txdb)
length(genes)
# [1] 30969
names(genes)[1:5]
# [1] "1"         "10"        "100"       "1000"      "100008586"

# Calculate lengths (this uses the exons of the genes)
gene_lengths <- width(reduce(genes))
gene_lengths <- as.numeric(gene_lengths)
length(gene_lengths)
# [1] 26269
gene_lengths[1:3]
# [1] 2541 1556 6167

RPKM, FPKM, TPM and DESeq

> set.seed(1)
> dds <- makeExampleDESeqDataSet(m=4)
> head(counts(dds))
      sample1 sample2 sample3 sample4
gene1      14       1       1       4
gene2       5      17      13      14
gene3       0      12       8       6
gene4     152      62     149     110
gene5      23      36      33      94
gene6       0       1       1       4
> dds <- estimateSizeFactors(dds)
> sizeFactors(dds)
 sample1  sample2  sample3  sample4
1.068930 1.014687 1.010392 1.033559
> head(counts(dds))
      sample1 sample2 sample3 sample4
gene1      14       1       1       4
gene2       5      17      13      14
gene3       0      12       8       6
gene4     152      62     149     110
gene5      23      36      33      94
gene6       0       1       1       4
> head(counts(dds, normalized=TRUE))
         sample1    sample2     sample3    sample4
gene1  13.097206  0.9855256   0.9897147   3.870122
gene2   4.677574 16.7539354  12.8662916  13.545427
gene3   0.000000 11.8263073   7.9177179   5.805183
gene4 142.198237 61.1025878 147.4674957 106.428358
gene5  21.516838 35.4789219  32.6605863  90.947869
gene6   0.000000  0.9855256   0.9897147   3.870122

# normalized counts is calculated as the following
R> head(scale(counts(dds, normalized=F), F, sizeFactors(dds)))
         sample1    sample2     sample3    sample4
gene1  13.097206  0.9855256   0.9897147   3.870122
gene2   4.677574 16.7539354  12.8662916  13.545427
gene3   0.000000 11.8263073   7.9177179   5.805183
gene4 142.198237 61.1025878 147.4674957 106.428358
gene5  21.516838 35.4789219  32.6605863  90.947869
gene6   0.000000  0.9855256   0.9897147   3.870122

# The situation of DESeqDataSet object created using 'tximport()' is different. See the next item.
P -- per
K -- kilobase (related to gene length)
M -- million (related to sequencing depth)

Sample size

Power-> RNA-seq

Coverage

~20x coverage ----> reads per transcript = transcriptlength/readlength * 20
C = L N / G

where L=read length, N =number of reads and G=haploid genome length. So, if we take one lane of single read human sequence with v3 chemistry, we get C = (100 bp)*(189×10^6)/(3×10^9 bp) = 6.3. This tells us that each base in the genome will be sequenced between six and seven times on average.

# Assume the bam file is sorted by chromosome location
# took 40 min on 5.8G bam file. samtools depth has no threads option:(
# it is not right since it only account for regions that were covered with reads
samtools depth  *bamfile*  |  awk '{sum+=$3} END { print "Average = ",sum/NR}'    # maybe 42

# The following is the right way! The result matches with Qualimap program.
samtools depth -a *bamfile*  |  awk '{sum+=$3} END { print "Average = ",sum/NR}'  # maybe 8
# OR
LEN=`samtools view -H bamfile | grep -P '^@SQ' | cut -f 3 -d ':' | awk '{sum+=$1} END {print sum}'`   # 3095693981
SUM=`samtools depth bamfile | awk '{sum+=$3} END { print "Sum = ", sum}'`   # 24473867730
echo $(( $LEN/$SUM ))

5 common genomics file formats

5 genomics file formats you must know (video)

  • fastq,
  • fastq,
  • bam,
  • vcf,
  • bed (genomic intervals regions)

SAM/Sequence Alignment Format and BAM format specification

Single-end, pair-end, fragment, insert size

Germline vs Somatic mutation

  • Germline: inherit from parents. See the Wikipedia page.
  • Somatic SNVs are mutations that occur in the cells of a tumor. These mutations can be found in multiple copies of the same gene, while germline SNVs are mutations that are found in a single copy of the gene, usually the original copy.
  • Somatic & Germline Mutations

Pathogenic mutation

  • A pathogenic mutation is a change in the genetic sequence that causes a specific genetic disease. To determine if a change found in the gene is something that causes disease, a laboratory looks at many different factors. For example, they look at the type of change found. Some changes, like nonsense mutations or frameshift mutations, almost always result in a major problem with the protein produced, so they are often labeled as pathogenic mutations. Laboratories will also check the scientific literature and databases to see if the particular change has been reported in other individuals with the genetic disease. Lastly, they look to see if the change is in an area of the gene that is conserved across species, meaning that the area where the change is located is the same in lots of animals, thus may be an important area for the function of the protein.
  • pathogenic variant. See Genetic Disorders
  • Pathogenic means able to cause or produce disease.
  • What are some examples of genetic diseases caused by pathogenic mutations? Cystic fibrosis, Duchenne muscular dystrophy, Familial hypercholesterolemia, Hemochromatosis, Sickle cell disease, Tay-Sachs disease ...

Driver vs passenger mutation

https://en.wikipedia.org/wiki/Somatic_evolution_in_cancer

Nonsynonymous mutation

It is related to the genetic code, Wikipedia. There are 20 amino acids though there are 64 codes.

See

isma: analysis of mutations detected by multiple pipelines

isma: an R package for the integrative analysis of mutations detected by multiple pipelines

mutSignatures: analysis of cancer mutational signatures

Rediscover: identify mutually exclusive mutations

Rediscover: an R package to identify mutually exclusive mutations

Tumor mutational burden

Types of mutations

Cytogenetic alternations

Alternative and differential splicing

Allele vs Gene

http://www.diffen.com/difference/Allele_vs_Gene

  • A gene is a stretch of DNA or RNA that determines a certain trait.
  • Genes mutate and can take two or more alternative forms; an allele is one of these forms of a gene. For example, the gene for eye color has several variations (alleles) such as an allele for blue eye color or an allele for brown eyes.
  • An allele is found at a fixed spot on a chromosome?
  • Chromosomes occur in pairs so organisms have two alleles for each gene — one allele in each chromosome in the pair. Since each chromosome in the pair comes from a different parent, organisms inherit one allele from each parent for each gene. The two alleles inherited from parents may be same (homozygous) or different (heterozygotes).

Locus

https://en.wikipedia.org/wiki/Locus_(genetics)

Haplotypes

Base quality, Mapping quality, Variant quality

VarSAP

Enrichment of Variant Information for the Variant Standardization and Annotation Pipeline

The Clinical Knowledgebase (CKB)

https://ckb.jax.org/gene/show?geneId=7157 (TP53)

Mapping quality (MAPQ) vs Alignment score (AS)

http://seqanswers.com/forums/showthread.php?t=66634 & SAM format specification

  • MAPQ (5th column): MAPping Quality. It equals −10 log10 Pr{mapping position is wrong} (defined by SAM documentation), rounded to the nearest integer. A value 255 indicates that the mapping quality is not available. MAPQ is a metric that tells you how confident you can be that the read comes from the reported position. So given 1000 reads, for example, read alignments with mapping quality being 30, one of them will be wrong in average (10^(30/-10)=.001). Another example, if MAPQ=70, then the probability mapping position is wrong is 10^(70/-10)=1e-7. We can use 'samtools view -q 30 input.bam' to keep reads with MAPQ at least 30. Users should refer to the alignment program for the 'MAPQ' value it uses.
  • AS (optional, 14th column in my case): Alignment score is a metric that tells you how similar the read is to the reference. AS increases with the number of matches and decreases with the number of mismatches and gaps (rewards and penalties for matches and mismatches depend on the scoring matrix you use)

Note:

  1. MAPQ scores produced by the aligners typically involves the alignment score and other information.
  2. You can have high AS and low MAPQ if the read aligns perfectly at multiple positions, and you can have low AS and high MAPQ if the read aligns with mismatches but still the reported position is still much more probable than any other.
  3. You probably want to filter for MAPQ, but "good" alignment may refer to AS if what you care is similarity between read and reference.
  4. MAPQ values are really useful but their implementation is a mess by Simon Andrews

gene's isoform

FFPE Tissue vs Frozen Tissue

Wild type vs mutant

ns

Not significant

PARP inhibitor

  • What is a PARP Inhibitor? Dana-Farber Cancer Institute
  • PARP is an enzyme/a family of proteins that help repair damaged DNA in cells. When DNA is damaged, PARP detects the damage and signals other enzymes to come and fix it. This helps maintain the stability of the cell’s genetic material and prevent cell death.
  • Is PARP good or bad? PARP is neither inherently good nor bad. It is a protein that plays an important role in maintaining the stability of the cell’s genetic material by helping to repair damaged DNA.
    • In normal cells, PARP helps prevent cell death and maintain genomic stability.
    • In cancer cells, PARP can help the cancer cells survive and continue to grow by repairing their DNA. This is why PARP inhibitors (PARPi) are used in cancer treatment to block the function of PARP and prevent cancer cells from repairing their DNA.
  • PARP inhibitors are a type of targeted cancer therapy, not a traditional chemotherapy.
  • PARPi therapy is a cancer treatment that blocks the PARP enzyme, which helps repair DNA damage in cancer cells
    • PARP Inhibitors: Clinical Relevance, Mechanisms of Action and Tumor Resistance
    • List of PARP inhibitors: olaparib, niraparib, rucaparib, and talazoparib.
    • Olaparib is a medication for the maintenance treatment of BRCA-mutated advanced ovarian cancer in adults. It is a PARP inhibitor, inhibiting poly ADP ribose polymerase (PARP), an enzyme involved in DNA repair. Others include Letrozole, Avastin.
    • Maintenance therapy is called so because it is the ongoing treatment of cancer with medication after the cancer has responded to the first recommended treatment. The main goals of maintenance therapy are
      • To prevent the cancer’s return
      • To delay the growth of advanced cancer after the initial treatment
  • PARP inhibitors are a class of drugs that inhibit the activity of PARP enzymes. By blocking PARP’s ability to help repair DNA damage, these drugs can make it more difficult for cancer cells to survive DNA damage caused by other treatments, such as chemotherapy or radiation therapy. This can make these treatments more effective against certain types of cancer.
  • PARP inhibitors are drugs that block the action of the PARP enzymes, which are involved in DNA repair. There are several PARP inhibitors available, including olaparib (Lynparza), niraparib (Zejula), rucaparib (Rubraca), and talazoparib (Talzenna). These drugs are approved for some types of cancer, such as ovarian and prostate cancer, depending on the presence of certain genetic mutations.

Inhibitor genes and activator genes/enhancer genes

  • Inhibitor genes: Inhibitor genes are genes that code for proteins that can regulate or inhibit the activity of other genes or proteins in a cell. These inhibitor proteins can interact with other proteins to prevent them from functioning or alter their activity.
    • TP53 gene, which codes for the p53 protein, a tumor suppressor protein that plays a critical role in regulating cell division and preventing the formation of cancerous tumors. Mutations in the TP53 gene can result in loss of p53 function and an increased risk of cancer.
  • Activator genes: Activator genes play crucial roles in a variety of biological processes, including embryonic development, immune system responses, and the regulation of gene expression. For example, the NF-kB gene codes for a transcription factor that activates genes involved in immune system responses.
    • The MYC gene is an oncogene that codes for a transcription factor that promotes cell growth and proliferation. Dysregulation or overexpression of MYC can contribute to the development of many types of cancer.
    • Overexpression of the HER2 (human epidermal growth factor receptor 2) gene is commonly observed in certain types of cancer, particularly breast cancer. Approximately 20-25% of breast cancer cases overexpress HER2, which is associated with a more aggressive form of the disease.
    • Overexpression of the epidermal growth factor receptor (EGFR) gene is a common genetic alteration observed in glioblastoma multiforme (GBM) patients.
  • It's important to note that the distinction between inhibitor and activator genes is not always clear-cut, as many genes can have both inhibitory and activating effects depending on the context and the specific proteins they interact with.
  • Normal/cancer cells and PARP Inhibition:
    • Normal cells can tolerate DNA damage caused by PARP inhibition due to their efficient homologous recombination (HR) mechanism.
    • In contrast, cancer cells with a deficient HR struggle to manage the DNA double-strand breaks (DSBs) and are especially sensitive to the effects of PARP inhibitors (PARPi)
    • PARP has been found to be overexpressed in various types of cancers, including breast, ovarian, and oral cancers, compared to their corresponding normal healthy tissues.
    • This overexpression makes inhibition of PARP activity an attractive strategy for cancer therapeutics. By disrupting PARP functions, it impairs DNA damage repair (DDR) pathways in cancer cells.
    • After cancer patients receive PARP inhibitor (PARPi) drugs, the expression of PARP genes in cancer patients tends to be lower compared to normal patients.

Undifferentiated cancer

  • Medical Definition of Undifferentiated cancer (不好的 tumor)
  • What are undifferentiated cells
    • Undifferentiated cells are cells that have not yet developed into a specific type of cell and do not possess the characteristics of a fully differentiated cell. They are also known as stem cells or progenitor cells.
    • In developmental biology, undifferentiated cells are the cells that have not yet undergone differentiation, the process by which a less specialized cell becomes a more specialized cell, with a specific function and characteristics. These cells have the potential to divide and differentiate into multiple cell types, either through normal development or in response to injury or disease.
    • In the context of cancer, undifferentiated cells refer to cells that have not yet developed into a specific type of cancer cell. These cells are sometimes called cancer stem cells, and they are thought to be the cells that give rise to the various types of cells within a tumor. They are believed to be responsible for the maintenance and growth of the tumor, and for its ability to spread to other parts of the body. They can be found within many types of cancer, and are considered to be an important target for cancer therapy, as they are thought to be more resistant to traditional treatments such as chemotherapy and radiation.
  • Differentiation refers to the process by which cells develop and mature to perform specific functions. Normal cells are considered highly differentiated because they have specialized structures and functions. When cancer cells are described as well-differentiated, it means that these cells have retained many of the characteristics and functions of normal cells. In contrast:
    • Moderately differentiated cancer cells have lost some of these normal characteristics and appear more abnormal.
    • Poorly differentiated cancer cells look very different from normal cells and lack the specialized functions of healthy tissue. They tend to grow and spread more aggressively because they are less "mature" in their development.
  • Undifferentiated cancers generally have a worse prognosis compared to well-differentiated tumors for several reasons:
    • Aggressive behavior: Undifferentiated cancer cells tend to grow and spread more quickly than well-differentiated cells.
    • Lack of normal cell functions: These cancer cells have lost many of the characteristics and functions of normal cells, making them more difficult for the body to control or recognize.
    • Resistance to treatment: Undifferentiated cancers often respond poorly to conventional treatments like chemotherapy.
    • Advanced stage at diagnosis: These cancers are frequently diagnosed at later stages due to their rapid progression and difficulty in detection.
    • Cellular disorganization: The lack of cellular organization makes these tumors more invasive and harder to treat surgically.
    • Difficulty in targeting: The absence of specific cellular markers makes it challenging to develop targeted therapies.
    • Rapid metastasis: Undifferentiated cancers have a higher tendency to spread to other parts of the body quickly

NCI Information Technology for Cancer Research program /ITCR

https://itcr.cancer.gov/. Videos. It sponsors several programs like Bioconductor, GenePattern, UCSC Xena, IGV, PDX Finder, WebMeV, et al.

Other software

Partek

dCHIP

MeV

MeV v4.8 (11/18/2011) allows annotation from Bioconductor

IPA from Ingenuity

Login: There are web started version https://analysis.ingenuity.com/pa and Java applet version https://analysis.ingenuity.com/pa/login/choice.jsp. We can double click the file <IpaApplication.jnlp> in my machine's download folder.

Features:

  • easily search the scientific literature/integrate diverse biological information.
  • build dynamic pathway models
  • quickly analyze experimental data/Functional discovery: assign function to genes
  • share research and collaborate. On the other hand, IPA is web based, so it takes time for running analyses. Once submitted analyses are done, an email will be sent to the user.

Start Here

Expression data -> New core analysis -> Functions/Diseases -> Network analysis
                                        Canonical pathways        |
                                              |                   |
Simple or advanced search --------------------+                   |
                                              |                   |
                                              v                   |
                                        My pathways, Lists <------+
                                              ^
                                              |
Creating a custom pathway --------------------+

Resource:

Notes:

  • The input data file can be an Excel file with at least one gene ID and expression value at the end of columns (just what BRB-ArrayTools requires in general format importer).
  • The data to be uploaded (because IPA is web-based; the projects/analyses will not be saved locally) can be in different forms. See http://ingenuity.force.com/ipa/articles/Feature_Description/Data-Upload-definitions. It uses the term Single/Multiple Observation. An Observation is a list of molecule identifiers and their corresponding expression values for a given experimental treatment. A dataset file may contain a single observation or multiple observations. A Single Observation dataset contains only one experimental condition (i.e. wild-type). A Multiple Observation dataset contains more than one experimental condition (i.e. a time course experiment, a dose response experiment, etc) and can be uploaded into IPA in a single file (e.g. Excel). A maximum of 20 observations in a single file may be uploaded into IPA.
  • The instruction http://ingenuity.force.com/ipa/articles/Feature_Description/Data-Upload-definitions shows what kind of gene identifier types IPA accepts.
  • In this prostate example data tutorial, the term 'fold change' was used to replace log2 gene expression. The tutorial also uses 1.5 as the fold change expression cutoff.
  • The gene table given on the analysis output contains columns 'Fold change', 'ID', 'Notes', 'Symbol' (with tooltip), 'Entrez Gene Name', 'Location', 'Types', 'Drugs'. See a screenshot below.

Screenshots:

File:IngenuityAnalysisOutput.png

DAVID Bioinformatics Resource

It offers an integrated annotation combining gene ontology, pathways and protein annotations.

It can be used to identify the pathways associated with a set of genes; e.g. this paper.

GOTrapper

GOTrapper: a tool to navigate through branches of gene ontology hierarchy

qpcR

Model fitting, optimal model selection and calculation of various features that are essential in the analysis of quantitative real-time polymerase chain reaction (qPCR).

GSEA

sandbox.bio: Interactive bioinformatics tutorials

https://sandbox.bio/. An interactive playground for learning bioinformatics command-line tools like bedtools, bowtie2, and samtools.

GWAS

Genome-wide association studies in R